Transcript asmbl_20376

Sequence
Transcript Sequence for observation asmbl_20376 of TGE0003991:
CACACACACACTTAACTGTTTCTTTAGGGAGTTCTACATGTCCTTTTTTCAGACCAGATCCTGTAGTTGTCCCAGGGTCCCTTCCAGGGGTGGGAAGTCCCCATGCCTTACTGGCTGAGGTGAAGGGATGCTGACCTGCTGACAGGTACGCAACAGGACGCACAACAGGAGTGGTCTTAGATTCAGGGGACGGGGTCACCCATGCTGTTCCCATCTACGAGGGCTTTGCCATGCCGCATTCCATCATGCGGGTGGACATTGCCGGCCGCGACGTCTCCCGCTATCTCCGGCTGCTGCTGCGCAAGGAAGGCGTTGACTTTCACACCTCAGCTGAGTTTGAGGTTGTCCGAACCATCAAAGAGCGGGCCTGCTACCTGTCCATCAACCCACAGAAGGATGAGGCTCTGGAGACAGAGAAGGTGCAGTATACTTTGCCGGATGGCAGCATACTCGACGTGGGGCCAGCACGATTCCGGGCCCCTGAGCTGCTGTTCCAGCCGGACCTGGTGGGGGACGAGAGTGAGGGGCTCCATGAGGTGCTGGCTTTTGCCATCCACAAGTCCGACCTGGACCTCCGCCGGACACTGTTCGCCAACATTGTGCTTTCAGGCGGCTCCACGCTGTTCAAAGGCTTTGGGGACCGATTACTAAGTGAAGTGAAGAAGCTTGCACCAAAGGATGTCAAAATCAAGATCTCGGCCCCCCAGGAACGGCTGTACTCCACATGGATCGGTGGCTCCATCCTGGCCTCACTGGACACTTTCAAGAAGATGTGGGTCTCCAAGAAGGAGTACGAGGAGGATGGCGCCCGTGCTATTCATCGTAAAACCTTCTAGCGCCCAAGGAGAAAGGCAGTGTGCTGGGCGAGTGGGAAGAAAGGGGCCAGAGCCCCAACCCTGTCTGGTCTGGGCCCACATACACCAGGCCCAGGGTTCCCTGTGTGCCCTGAACCCCGGGAAGGCGGTACAGCATCTTCCCTGCAGCCCTCCCCTTTGCACACACACGCACACACAGTAACGTTTAGCTGCATGGGTGGGGGTCTTGAGCTGGAACATAGAAATTGATGTGCCCAGCCATAGGTGGTTCTGGGTGTCCCTTTGGCAGGGCCAGTTAGGGCTACGG