Transcript asmbl_20375

Sequence
Transcript Sequence for observation asmbl_20375 of TGE0003990:
GGAGCCGCCGCGGTCCAGTCCTTCTGCCTGCCCGCCTGTTCGCTAGTCCCTCCTGCCGCCCGCCTGCTGGGCAGGGCCGGCCCGGCCCGGCCCGGCCATGGAGTCCTACGATATCATCGCCAACCAGCCCGTGGTCATCGACAACGGTTCGGGAGTGATCAAGGCTGGCTTTGCAGGAGACCAGATTCCCAAATACTGTTTCCCAAACTATGTCGGGCGCCCTAAGCACATGCGGGTGATGGCTGGAGCCTTGGAAGGGGACCTCTTCATGGGACCAAAAGCAGAGGAGCACCGGGGGCTTCTGGCCCTGCGCCACCCCATGGAGCACGGCGTTGTGCGGGACTGGAATGACATGGAGCGCATCTGGCAGTATGTCTACTCCAAGGACCAGCTGCAGACCTTCTCCGAGGAGCATCCTGTCCTTCTAACGGAAGCCCCGCTCAACCCAAGTAAGAACCGGGAGAAGGCGGCAGAGGTGTTTTTTGAGACCTTCAACGTGCCAGCCCTGTTTATCTCCATGCAGGCCGTGCTCAGCCTGTACGCAACAGGACGCACAACAGGAGTGGTCTTAGATTCAGGGGACGGGGTCACCCATGCTGTTCCCATCTACGAGGGCTTTGCCATGCCGCATTCCATCATGCGGGTGGACATTGCCGGCCGCGACGTCTCCCGCTATCTCCGGCTGCTGCTGCGCAAGGAAGGCGTTGACTTTCACACCTCAGCTGAGTTTGAGGTTGTCCGAACCATCAAAGAGCGGGCCTGCTACCTGTCCATCAACCCACAGAAGGATGAGGCTCTGGAGACAGAGAAGGTGCAGTATACTTTGCCGGATGGCAGCATACTCGACGTGGGGCCAGCACGATTCCGGGCCCCTGAGCTGCTGTTCCAGCCGGACCTGGTGGGGGACGAGAGTGAGGGGCTCCATGAGGTGCTGGCTTTTGCCATCCACAAGTCCGACCTGGACCTCCGCCGGACACTGTTCGCCAACATTGTGCTTTCAGGCGGCTCCACGCTGTTCAAAGGCTTTGGGGACCGATTACTAAGTGAAGTGAAGAAGCTTGCACCAAAGGATGTCAAAATCAAGATCTCGGCCCCCCAGGAACGGCTGTACTCCACATGGATCGGTGGCTCCATCCTGGCCTCACTGGACACTTTCAAGAAGATGTGGGTCTCCAAGAAGGAGTACGAGGAGGATGGCGCCCGTGCTATTCATCGTAAAACCTTCTAGCGCCCAAGGAGAAAGGCAGTGTGCTGGGCGAGTGGGAAGAAAGGGGCCAGAGCCCCAACCCTGTCTGGTCTGGGCCCACATACACCAGGCCCAGGGTTCCCTGTGTGCCCTGAACCCCGGGAAGGCGGTACAGCATCTTCCCTGCAGCCCTCCCCTTTGCACACACACGCACACACAGTAACGTTTAGCTGCATGGGTGGGGGTCTTGAGCTGGAACATAGAAATTGATGTGCCCAGCCATAGGTGGTTCTGGGTGTCCCTTTGGCAGGGCCAGTTAGGGCTACGG