Transcript asmbl_15071

Sequence
Transcript Sequence for observation asmbl_15071 of TGE0003804:
GGACAGCCCCATGGGGCCTGAAGGGGCTTCGTATGGCAACCGGTACAGTTGAGAGTTCAACGGCGCGTTGCAAAGATGCCGCCCAAAGGAAAAAGCGGTTCTGGAAAAGGGGGAAAAGGGGGAGCAGCTTCTGGGAGTGACACTTCTGACAAGAAGTCTCAGGGTCCCAAAGGTGGTGGCAATGCAGTAAAGGTCAGACACATTCTGTGCGAAAAACACGGGAAAATCATGGAAGCCATGGAAAAGCTGAAGTCTGGAATGAGATTCAATGAAGTGGCCGCACAGTACAGTGAAGATAAAGCCAGGCAGGGGGGCGACCTGGGCTGGATGACCAGAGGGTCCATGGTGGGGCCATTTCAAGAAGCAGCATTTGCCTTGCCTGTAAGTGGGCTGGACAAGCCTGTGTTTACAGACCCTCCGGTTAAGACAAAATTTGGATATCATATTATTATGGTTGAAGGGAGAAAATAAAACTATCGCAAGACCGAA