Transcript asmbl_19631

Sequence
Transcript Sequence for observation asmbl_19631 of TGE0026719:
GACGTGTTCAGAGATGCTATGACCCTCATGAAGCTGGACATAAAGAAGTTGCCCCAGGAAATGCTGAGCCAGCTGCAGATTACACAGGGCTTTGCGGCCTTAGAGAAGCTGGAGGAGGCCCTGAAAGCCCCCACAGATGCTGGCCACAGCCTGAACGAGCTGTCCTCCCGCTTTTACACCATCATTCCCCACAACTTCGGCCGCAAAAAGCCCCCGCCCATTGACTCCTTCAAGCTTCTGCAGACAAAGAAGGACATGCTGCTGGTGCTAGACACCGTCGTCAAGCTGGTCCAGACCCAGGAGGCAGCCCTCGAGGAAGAGGAGGTGGAGGATGTGCCACATCCACTGGACCGAGCCTACCGGCTCCTCAAGTGCCAGCTCCAGCTGCTAGACCAAGAGGAGCCTGAGTACAAGATGATACAAACCTACTTAGGAGAGACTGGCAAGTACTACGAGCGCCTTGGTCTGGACCATGTTTGGAAAGTGAACCGAGACGGGGAGATGAGCGAGAGTACCCCACCGCCCTCCCCTGCCATCACTCAGACTCGCAGTGAGAGAGATAAGCTCCAGGCCCACTCCAAGCTGGACAATTGGAAGCCACTGTGGCATGGCACCAACGTGGCTGTGGTGGCCACCATCCTCAACAATGGGTTCCGCATTACCAAAAGTCTTGTTAGTAAGAGCACCTACTTAGCCTTGGAGAACAGTAAGTCCACCGGCTATGGCAAGGCGCCCCTCAGGCCAAGCCCTGGGCGGTGTGGGGGCAGGAGGGTTGGGCCTGGTGTTTACCCAGTTTGTGGAGGATCGGGGAGAGGAACCCTAGCATGCTTACCAGCCACAAAGCTCAGTGGGGCGTCCCAGGGCTTGGGGGGTTTCGGGACAGCTTCTTTGCGAAGGCCACACAGCTGGGTGAGCATACCAACCAGACCTGGGAAGAGGTCAAAGAGGAGCCTTCAAGGTAAAGCAGCCAGGGGGCGTCACAGAGGCTGGGAGGCTCCCGCAGGTCAGGACCTCCAAGTGTGGCTGATAGTGAAGCTTAGAGCAAATGCCTCATGTGGCAGGGATGTGAGGGCCTGGAAAGATCAAGGGGGCCTTACCCAGAAAGCCATGAGGAGCCCATGTGGACCTGTGCAGAGCAGGATTTCAGTGGCTGCAGCCGTGGAGAGGGCGGCAGAGGCCAGAGGCTACAGGGAGGTGGTGCTGGCATCGGGCCAGATGTGGTGGGCACCCGGGCCACAGCAGGGGAAGTGGGGGAGGAGGGAATCCGTGAGAGGGATATGCGGGAGGTGGGATGGCAGCGTGTGGGAAAAGGTCGAAGGTGTATCCTGACGCCCAAGTTTCTGTCCAGAGTGTCCTTAACTGAGGTGACCTCCCCAGACTGTCTCCTCAGCACGGGCTGACCCCATTATTAGAGACCACTACCCCCCACCCATCCAAGAGAGCAAGGTCCAAGGGCAGATGGGGCTGAAGTTCTGGGATGCCCGTGGTTGCCCACGGCCCGGGGGTCCAGCAGGAGGACAGAGGGGCCTCAGAAGGCATGGAGGGTGGCCTCAGGGGAGCCAGTGCTAGGGGGTCCCAAGGTAAAGGGTGAAAAATGCTAGTGGCAAAATCAGCAGAGCGGGCCCGGGAGAAAAGCCCCCGCCCCAGATTTGGTCACTGGGAGGCCAGTACTGACCTTGGGGAGGGTGGCGGGGCCGGGGCAGAGGCTGGCCTCAGTGAGCCTAGGCATGGGGCAAAGAGATGGGCGGGAGCATGGCCAGGACAAGGGGTGTTTTTAAGGACGGAGGAAGAATGGGCACCTTTCTGGACTGGGACAGCACAGTCAGAGGAGAGAACAATGCAGCGGAGGAATCCAGGGAGTCCGGCAGGAGGGCCGAGCCGCCCAGCCGGAGTCTCGCTGTGTCCCCCAGTTTCTGGCATGTCCTACAAGGATGACCACCATGTCAGCTACATGTTCCTGGGTGAGGAGACACCGGACAGAGAGCACCACACCACCGTCGACGAGCCCAGCGTGAAGCAGCCAGACCCCGGCTTTGACAGCGTCATCGCCCGAGGCCACACAGAGCCACGTTCAACAAATCGTTTCTGGGCATCCAGGAAGGCTTCCAAGAAGAGGTGTCATTGACTAAGCGTTGAAAGATGAATCTGACCCAGGACACTGAGCTG