Transcript asmbl_19536

Sequence
Transcript Sequence for observation asmbl_19536 of TGE0001731:
AGTGCCTTTCATCTGAGAAGTTCAAGGCACTTCGTAGAACTTCTGCCACACAGGCCGTGGGTCTTGCAGCACATTTGTAAGCAATGGCTGCCATCAGGAAGAAATTGGTGATTGTTGGTGATGGAGCCTGTGGCAAGACCTGCTTGCTTATCGTTTTTAGCAAGGACCAGTTTCCAGAGGTGTATGTACCCACAGTGTTTGAGAACTATGTGGCAGATATTGAAGTGGATGGAAAGCAGGTAGAGTTGGCTTTGTGGGACACAGCTGGGCAGGAAGATTATGATCGCTTGAGGCCCCTCTCCTACCCGGACACTGATGTTATACTGATGTGTTTCTCCATTGACAGCCCTGATAGTTTAGAAAACATCCCAGAAAAATGGACTCCGGAAGTCAAGCATTTCTGTCCCAATGTGCCCATCATCCTGGTTGGAAACAAGAAGGACCTTCGGAATGATGAGCACACAAGGCGGGAGCTAGCCAAGATGAAGCAGGAGCCGGTAAAACCAGAAGAAGGCAGAGATATGGCGAACAGGATTGGCGCTTTTGGGTACATGGAGTGTTCAGCAAAAACCAAAGATGGAGTGAGGGAGGTTTTTGAAATGGCCACGAGAGCTGCTCTGCAAGCCAGACGTGGGAAGAAAAAATCTGGGTGCCTTGTCTTGTGAAACCCTGCTGCAAGCACAGCCCTCATGCGGTTAATTTTGAAGTGCTGTTTATTAATCTTAGTGTATGATTACTGGCCTTTTTCATTTATCTATAATTTACCTAAGATTACAAATCAGAAGTCATCCTGCTACCAGTATTTAGAAGCCAAGCCAACCATGATTATTAATGATGTCCAGCCCACCTGACCCGCCGGGGGCCTTCTGACACCGCTCTAACAGCCCTCCTCTGCACTCCACCTGACACACCAGGCACTAATTCAAGGGATTTCTTAACTTCTTGCTTCTTTCTAGAAAGAGAAATGGTAACTTTTGTGAATTAGGCTGTAACTACTTCATAACTAACATGTCTTGCCTCTCATCTGTCAGCTGCAACGTATTCTGGTGAGTCACCACTTCAGAGCTTTACTCCTTAACAGATTGCATTGGCATAGCTCTGGAGTGGCCATCCAGTTTTTTCAAAATGGGCTCAGCCAGAAAGGCCCAAGTCCATGCAGCTGTGGCAAAGTTACAGTTCTGTGGTTTCATGTTAGTTACCTTATAGTTACTGTGTAATTAGTGCCACTTAATGTATGTTACCAAAAATAAATATATCTACCCCAGACTAGATGTAGTATTTTTTGTATAATTGGATTTCCTAATACTGATATTTGTCATCCCCACAGAAAGTGTATTGGTTTTTTAAAAAAGAAAGTGTATTTGAAAATAAAGTCAGATGGAAAATTCATTTTTTAAATTCCCGTTTTGTCAGTTTCTCTGATAAAAGATGACCATCTCACCTGTTTTCAGCCCCACATGTCCCAGTCCCCCTCCCCAGAGCTGGGCTAAGTAAGTAGGAATTTGGTTTCAAGCGCCCGAGGCACTCAGACACTTCTGAAGGTGGCACAACCTGTCTGGACCGCAGGGTCGGCCTCTAGTTCACAGTGCTTTCTCCTCACTGTATCTAGGTTCCCTCCCAGAGGAGCCACCAGTTCTCGTGGGTGGCACTGTGTTTCTCTCCTCTCCAGCTGACTAAACTTTTTTTCTGTACCAGTTAATTTTTCCAACTACTAATAGAATAAAGGCAGTTTTCT