Transcript asmbl_19018

Sequence
Transcript Sequence for observation asmbl_19018 of TGE0001880:
GCGGAGCCGGATTCTTGGCCATAAAGCCCGAGGCGGCGGTGGTGGCGGCGGCTTTGGAAGCTTGGAGAGCGACGAAGAGTCCGCTGAAACCGGAACTTGGACTTCTCTGCCCCTGTCCTCGCCTTGTAGTTCCTCTTCAGCGGGAGCCTTCGTGACGTGCCCGGCCCGAAGCCCCGTTCGGAGCGGCCGAGTTTGAAGGATGACCTCTAGGAAGAAAGTGTTGCTGAAGGTTATCATCCTGGGAGATTCTGGAGTCGGTAAGACATCACTCATGAACCAGTATGTGAACAAGAAATTCAGTAATCAATACAAAGCCACAATAGGAGCAGACTTTCTGACAAAGGAGGTGATGGTGGATGACAGACTAGTTACAATGCAGATCTGGGACACGGCAGGACAGGAACGGTTCCAGTCTCTTGGTGTGGCCTTTTATAGAGGCGCAGACTGCTGTGTTCTGGTATTTGATGTGACTGCCCCGAACACATTCAAAACCCTTGATAGTTGGAGAGATGAGTTTCTCATCCAGGCCAGCCCTCGGGATCCTGAAAACTTTCCCTTTGTAGTGTTGGGAAATAAGATTGACCTCGAAAACAGACAAGTGGCCACGAAGCGAGCACAGGCCTGGTGCTACAGCAAAAACAACATTCCCTACTTTGAGACCAGTGCCAAGGAGGCCATCAACGTGGAGCAGGCCTTCCAGACGATTGCACGGAATGCACTTAAACAGGAAACAGAGGTGGAGCTGTACAATGAATTTCCTGAACCCATCAAACTGGACAAGAATGACCGGGCCAAGGCCTCGGCAGAAAGCTGCAGTTGCTGAATGGGCAATGAGAGCAGAGCACAGAGTCCTTCACAAACCAAGAACACACTTAGGCCTTCCAACATAAATCCCTTCTCCTCTTCTAAACAAAGCATAAAGTGATTTCTCAGACGCAGTTGCCAAAAGAAACCCCACCAGACACACTCACCCCTCCATACAACACACATACAAATCTGATACAAGCAGACAGACTCCAGTCACAGGCCTGTGAGCTCTATCAGGGTCTGCCCACCTATCACATCAGCCCTCGTATAGCAGCATGACAGGCCAGCTGTAGAAATCGTTCTGGTGTTGGCATCGGAAGCTAATTCTTTTTGTCCACCAGAGAGGGAGAACTGTTTACAGTTAATCTATGTCGGATTGGTTATCTTAATTTTTTTTAATGGTCTTGTGGTCTTTTTACCCCATCCCCATTCCCCTCTTGTGAAGGCTACCACTTGGGAAGGCTGGTGCCCTATGCTTCATTACAGGCTCACACCCAGTCTGTTCAGGCTGAGTTTTGTATGTATCTGTTAATGCTTGTTACTTTTAACTAATCAGATCTTTTTACAGTATCCATTTATTATGTAATGCTTCTTAGAAAAGAATCTTATAGTACATGTTAATATATGCAACCAATTAAAAATGTATAAATTAGTGTAAGAAATTCTTGGATTATGTGTTTAAGTCCTGTAATGCAGGCATGTAAGATGGAGGGTTGAACACTGTCTGGATTGCAGAATGTTAGCAACTCAATTCAGAAATCCAGCTAGAGGCAGTATTCTGTACAGTAAACACAAGAATTATGTACACCTTTTATCAAAGACTTAAGAGCCAAAAAGCTTTTCATCTCTCCAGGGGGAAAACTGTCTAGTTCCCTTCTGTATCTAAATTTTCCAAAAGGTTGATTTGCATAATACAGTGGTGAATGCAGTAGATAAATGGCTGTTGTTAAAATTCTTGTTTTTCCTTTTTTTCTTGCTCCACCCTTTGAAACTCCCCTATTAGATCAGCATCCTACTTATAAGAGGAAAAGGAAAATCCTAACAAATCTGTCCTAGTGATTTACCTTTGTTCTAGAAGGCGCTCTTTTCAGGGTTGTGGTATCCCTTAGGTTAGCAAACCTTTTTCTCCTTTTCCCCACCTCCCCAGTATTGCCCATTATTGATTAACCTGTTTCTTTGGTGTGGAATCCTGGCAGTTCTTCCCCCTTCCTAGGGTCTGCCCCTGCATTCTAGCTTGTTTAATGGAGCACTTCCCCCTTTCCCAAAGGTCTACATTCTAGGGTGTGGGCCAAGTTCTTTCTGTAAAGAGATGAACCTGATGCCAATAAAATGTAACAAGAGCAAAGATCA