Transcript asmbl_18826

Sequence
Transcript Sequence for observation asmbl_18826 of TGE0003908:
CGCGGGTTTCCGCGCGCCTCTTTGGCAGCTGGTCACATGGTGAGGGTGGGGGGTAAGGGGGCCGCTCTAGCCTGCGGCCTGTGTCTATGGTCTGGCCCATAGGGTCCAGCTGCCCCCGACAGAGTTCAAGTGTATGGCGCCGCAGGAACCGTCTCCGGGGCCCCGATAACGGGCCGCCCCCGCAGCTCCCGGCACGGGGTGAAGGTCTCCTTTGATCTGAGAATGGCTACCCCTCGATATGAGCCAGTGGCTGAGATTGGTGTTGGTGCGTATGGAACGGTGTACAAGGCCCGTGATCCCCACAGTGGCCACTTTGTCGCCCTCAAGAGCGTGAGAGTTCCCAATGGAGGTGCTGGAGGGGGCCTTCCCATCAGCACAGTTCGTGAGGTTGCTTTACTGAGGCGGCTGGAGGCTTTTGAGCATCCCAATGTTGTCCGGCTGATGGATGTCTGTGCCACAGCCCGAACTGACCGGGAAACCAAAGTGACCCTGGTGTTTGAGCATGTGGACCAAGACCTAAGGACGTATCTGGATAAGGCACCCCCACCAGGCTTGCCAGTGGAGACCATCAAGGATCTGATGCGCCAGTTTCTAAGAGGCCTAGATTTCCTTCATGCCAACTGCATTGTTCACCGGGACCTAAAGCCAGAGAACATTCTGGTGACAAGTGGTGGGACAGTCAAGCTGGCTGACTTTGGCCTGGCCAGAATCTACAGCTACCAGATGGCACTTACACCTGTGGTTGTTACACTCTGGTACCGTGCTCCAGAAGTTCTTCTGCAGTCTACGTATGCAACACCTGTGGACTTGTGGAGTGTTGGCTGTATCTTCGCTGAGATGTTTCGTCGAAAGTATGGGACTCAAGTATCCTGAACTATATTGAATATCCCAAATCTCTTATTCATAAACCACATCCCTACCCTGCCCATTCTTTCACTTGAGTATTACTGACCACCTTGTCCATAACCAGAAGCTCTGAAATGTCCTGGAGTTAGGAACTTATCTCTTTAGTCGCTATACCCTTTGTTTTTTAGCCACTAATCAATAATCATTCTACTACCA