Transcript asmbl_18816

Sequence
Transcript Sequence for observation asmbl_18816 of TGE0014907:
AATACCCTTACCACTGAGGCCCAGCGTTTGGATAAATTATTGGGGTTCCCTGTGCTGGGAGGTGTCACATCACCATCTACGCTTGCTCTCTAGCTTGGAGAGGGTCTGGGAGTGAAAGAGACACCCCAGCAAAAGTATCAGCGACTCCTGCATGAGGTCCAAGAGCTGACAAGTGAAGTCGAGAAAATCAAGACAGCAGTGAAGGAGTCAGCCACTGAGGAGAAGCTGACCCCCGTGGTGCTGGCTAAACAGCTGGCAGCCCTGAAGCAGCAGCTGCTTGCTTCCCACCTGGAGAAGCTACTGGGACCAGATGCAGCGATCAACCTTACTGACCCTGATGGAGCTCTGGCTAAGCGTCTGCTGCTGCAGCTGGAAGCAACAAAGAACAGCAAAGGGGCTGGTTCAGGGGGAAAGACCACAAGTGGGACCTTCCCAGATGGCAGCCTAGTCACTTATGAACTGCATTCTCGGCCTGAGCAGGACAAGTTCTCTCAAGCTGCCAAAGTTGCAGAACTTGAGAGGCGCCTGACAGAGCTGGAAGCAACTGTACGCTGTGATCAAGATGCCCAGAATCCCCTCTCTGCAGGTCTACAGGGAGCCTGCCTTACGGAAACTGTAGAGCTGTTGCAGGCAAAAGTGAGCTCCCTGGACCTTGCAGTTTTGGACCAAGTGGAGGCTCGGCTACAGAGTGTCCTGGGAAAGATGAATGAGATTGCCAAGCATAAAGCTTCTGTAGAGGATGCAGATACACAGAGCAAGGTGCACCAGCTATATGAAACCATACAGCGTTGGAGCCCCATCGCCTCCACCCTTCCTGAGCTGGTGCAGAGACTTGTCACCATCAAGCAGCTACATGAGCAAGCCATGCAGTTCAGTCAGCTCCTGACACACTTGGATACCACACAGCAGATGATAACTAGTTCCCTCAAGGACAATACCACCCTCTTGTCCCAGGTACAGACAACCATGCGTGAAAACCTGTCCACAGTTGAGGGGAATTTTGCCAACATTGATGAACGGATGAAGAAGCTGGGAAAGTGAGCCCCTTTGGAAGATGGAGAACAGGGGTAATGCCTACCCCTTTGAACTCTGTTAACAGCTTACATAGGGTTTCCCCTTAAATATAACTCGCGTATCCCCATCCCATTTGACACTAGGGACAAGGGTTCTTGCATGTGGGGTTTACATCCCTCCTCTGATGACTAGTGTGGTAGCTGGGGGATATTAGATGGTGGTGTCTCCTTGGGCCCCAGGGATGAGGACATGGGCTCAGCCACATGCCAGCTCACGTCTAATACTGCTTTGTCCAGTGTGGGGAAAGATTGGGTCCTGTCCTCCAGCACAGCTTCTGTGGCTGATTGTAACACTGTACAACTGTTTCTGACCATTAAATGCTGTTGTACTCTG