Transcript asmbl_18364

Sequence
Transcript Sequence for observation asmbl_18364 of TGE0026665:
CCTGGCGGGGCCGGCGGGGGCTGGAAGCTGGCAGAGGAAGAGTCTTGCAGGGAGGACGTGACCCGTGTGTGTCCCAAGCACACCTGGAGCAACAACCTGGCGGTGCTTGAGTGCCTGCAGGACGTGAGGGAGCCTGAAAATGAAATTTCTTCAGACTGTAATCATTTGTTGTGGAATTATAAGCTGAACCTAACTACAGATCCCAAATTCGAATCTGTAGCCAGAGAGGTTTGCAAATCTACCATTTCAGAGATTAAAGAATGTGCTGATGAACCAGTAGGAAAAGGTTACTTGGTTTCCTGCTTGGTGGATCACCGAGGCAACATCACTGAGTACCAGTGTCACCAATATATCACCAAGATGACGGCCATCATTTTCAGTGATTACCGTCTAATCTGTGGCTTCATGGATGACTGCAAAAATGACATCAACATTCTGAAATGTGGCAGCATTCGGCTTGGAGAAAAGGATGCACATTCACAAGGCGAGGTGGTCTCATGCTTGGAGAAAGGCCTGGTGAAAGAAGCAGAAGAAAGAGATCCCAAGATTCAAGTCTCTGAACACTGCAAGAAAGCCATTCTCCGGGTGGCCGAGCTGTCCTCAGATGACTTTCATTTAGACCGGCATTTATATTTTGCTTGCCGAGATGATAGGGAGCGTTTTTGTGAAAATACACAGGCTGGTGAAGGCAGAGTGTATAAGTGCCTCTTTAACCATAAATTTGAAGAATCCATGAGTGAAAAATGTCGAGAAGCATTAACAACCCGCCAAAAGCTGATTGCCCAAGATTATAAAGTCAGTTATTCATTGGCCAAATCCTGTAAGAGTGACTTGAAAAAATACCGGTGCAACGTGGAAAACCTTCCTCGATCCCGGGAAGCCAGGCTCTCCTACCTTCTGATGTGTCTGGAGTCAGCTGTGCATAGAGGGCGACAAGTGAGCAGTGAGTGCCAGGGGGAAATGTTAGATTACAGACGCATGTTGATGGAAGACTTTTCTTTGAGCCCTGAGATCATCCTGAGCTGTCGGGGGGAAATTGAACACCATTGCTCCGGATTACATCGAAAAGGGCGAACCCTACATTGTCTCATGAAAGTAGTTCGGGGAGAGAAAGGGAACCTTGGAATGAACTGCCAGCAGGCGCTGCAAACACTGATTCAGGAGACTGACCCTGGGGCAGATTACCGCATTGATCGAGCTTTGAATGAAGCTTGTGAATCTGTAATACAGACAGCCTGCAAACACATCAGATCGGGAGACCCAATGATCCTCTCATGCCTGATGGAACATTTATACACAGAGAAAATGGTGGAAGACTGTGAACACCGCCTGTTAGAACTGCAGTATTTCATCTCCCGAGATTGGAAGCTGGACCCTGTCTTATACCGCAAGTGCCAGGGAGATGCATCTCGTCTTTGCCACACCCACGGCTGGAATGAAACCAGTGAACTTATGCCTCCTGGAGCTGTGTTCTCTTGCTTATATAGACATGCCTACCGCACAGAGGAACAGGGCAGGAGGCTGTCACGGGAGTGCCGAGCTGAAGTGCAAAGGATTCTACACCAGCGTGCCATGGACGTTAAGCTTGATCCCGCCCTCCAGGATAAGTGCCTGATTGATCTGGGAAAATGGTGCAGTGAAAAAACAGAAACCGGACAGGAGCTTGAGTGCCTCCAGGATCATCTTGATGACTTGGCTGTAGAGTGCAGAGATATAGTCGGCAACCTCACCGAGTTAGAATCCGAGGATATTCAAATAGAAGCCTTGCTGATGAGAGCCTGCGAGCCCATAATTCAGAACTTTTGCCATGATGTGGCAGATAACCAGATAGACTCTGGGGACCTGATGGAGTGTCTGATACAGAACAAACACCAGAAGGACATGAATGAGAAGTGCGCCATTGGAGTCACCCACTTTCAGCTGGTACAGATGAAAGATTTTCGGTTCTCTTACAAGTTTAAAATGGCCTGCAAGGAGGATGTGTTGAAACTTTGCCCCAACATAAAGAAAAAAGTGGACGTGGTGATCTGCCTGAGCACCACCGTGCGCAATGACACTCTACAGGAAGCCAAGGAACACAGGGTGTCCCTGAAGTGTCGCAAGCAGCTGCGGGTGGAGGAGCTGGAAATGACAGAGGACATCCGTCTGGAACCAGAGCTGTATGAAGCCTGCAAGAGTGACATCAAGAGCTACTGTTCCGCTGTGCAGTATGGCAATGCCCAGATTATTGAATGTCTGAAAGAAAACAAGAAGCAACTAAGTACTCGTTGCCACCAGAAAGTTTTTAAGCTGCAGGAGACAGAGATGATGGACCCAGAACTGGATTATACACTCATGAGGGTCTGCAAGCAGATGATAAAGAGGTTCTGTCCAGAAGCGGATTCCAAAACCATGTTGCAGTGCTTGAAACAGAATAAAAACAGTGAACTGATGGATCCCAAATGCAAACAGATGATAACTAAGCGCCAGATTACCCAGAACACAGATTACCGCTTAAATCCTGTGCTAAGAAAAGCCTGTAAAGCTGACATTCCTAAATTCTGTCATGGTATCCTGACTAAGGCCAAGGATGATTCAGAGCTAGAAGGTCAAGTCATCTCTTGCCTCAAGCTGAGATATGCTGACCAGCGCCTCTCTTCAGACTGCGAAGACCAGATCCGGATTATTATCCAGGAGTCTGCTCTAGATTACCGACTTGATCCTCAGCTCCAGCTACACTGCTCAGATGAGATCTCCAGTCTCTGTGCAGAGGAAGCAGCAGCCCAAGAGCAGACAGGTCAGGTAGAGGAGTGCCTCAAGGTTAACCTGCTCAAAATCAAAACAGAAATGTGTAAAAAGGAAGTATTAAACATGCTGAAGGAAAGCAAAGCAGACATCTTTGTGGACCCAGTTCTTCATACAGCTTGTGCCCTGGACATTAAACACCACTGTGCAGCCATCACCCCCGGCCGAGGGCGTCAAATGTCCTGCCTCATGGAGGCCCTGGAGGATAAGCGGGTGAGGTTACAACCCGAGTGCAAAAAACGCCTCAATGACCGGATTGAAATGTGGAGTTATGCAGCAAAGGTGGCCCCAGCAGATGGCTTCTCTGACCTCGCCATGCAAGTGATGACATCCCCATCGAAGAACTACATTCTGTCTGTGATCAGTGGGAGCATCTGCATATTGTTCCTGATTGGCCTGATGTGTGGACGTATCACCAAACGAGTGACACGCGAGCTCAAGGACAGGTAGAGCCACCTTGACCACCAAAGGAACTACCTGTCCAGTGCCCAGTTTGTACAGCCCTCCTGTATAGCATACCCGTTCACCTCGTTCTTCTCAGAGGTGCCACCACCAACCATGTTAGAGCAGCAGCAGGTGTCCACTGCATTGTCCCATCTCAGACTTCGCCCGCTTCCATGGTGTCTCTCTTCGACCATTCGTAGCATCAGCAGCTGGCTACTTTGGTTATTGCCTTTCTTGGCAAACTCGGGATTACCTGCCCATAGACAAGTCTTTCTCATACCAATGGAACTACCAGTACTTCCAGAACCAACTCACTTGACCTGCAACTCAAATGAATTTTTTTAAAAAACAAAACAAAACAAACAAACAAAAAA