Transcript asmbl_17713

Sequence
Transcript Sequence for observation asmbl_17713 of TGE0003840:
CCAATGTCTCGTTGTGGGTGGGGTTATGCGGGGCGGACTGGGCAATAGGACTTCCGGAAATCTGTGCCGGAGCACCCCTGCTTCCTAATCAAAGGTCTTGCGAACACAGACCAGGACGCCGCAGGTTCTTTCTCCGCTGCCACCGCTCGCAAAGCTTTCCCGACCGACATGCCGTTCGTTGAGCTGGACACGAACTTGCCCGCCAACCGCGTGCCCGCGGGGCTGGAGAAGCGGCTTTGCGCAGCCAGCGCCGCCATCCTAGGCAAACCCGAGGACCGCATGAACGTGACGGTGCGTCCGGGCCTGGCTATGGCGGTGAGCGGCTCGGCCGAACCCTGTGCTCAGCTACTTGTCTCCTCTATCGGTGTAGTGGGCACTGCCGAGGATAACCGCGGCCACAGCGCCCGCCTCTTTGAGTTCCTCACCAAGGAGCTGGGACTAGGCCAGGAACGGATAATTATCCGCTTTTTCCCCCTGGAGCCCTGGCAGATTGGCAAGAATGGGACAGTCGTGACATTTTTATGATTGGCATGGAAGACATCCGGGGTATCTGTGAGCTGGCCACCTCTTCCAGAGAGGCCTCCTGGCATAGTGAAGGCCTGGTTGATCCCAGCTTCTGGCATCCCCACATGCAGATATGTCTGTGACCTCACAGTCCTCTTCATCTCCATCCTTATTCCAAATAAATGAAGAGAGCTTTGTCTTTC