Transcript asmbl_17005

Sequence
Transcript Sequence for observation asmbl_17005 of TGE0003804:
TGAAGGGGCTTCGTATGGCAACCGGTACAGTTGAGAGTTCAACGGCGCGTTGCAAAGATGCCGCCCAAAGGAAAAAGCGGTTCTGGAAAAGGGGGAAAAGGGGGAGCAGCTTCTGGGAGTGACACTTCTGACAAGAAGTCTCAGGGTCCCAAAGGTGGTGGCAATGCAGTAAAGGTCAGACACATTCTGTGCGAAAAACACGGGAAAATCATGGAAGCCATGGAAAAGCTGAAGTCTGGAATGAGATTCAATGAAGTGGCCGCACAGTACAGTGAAGATAAAGCCAGGCAGGGGGGCGACCTGGGCTGGATGACCAGAGGGTCCATGGTGGGGCCATTTCAAGAAGCAGCATTTGCCTTGCCTGTAAGTGGGCTGGACAAGCCTGTGTTTACAGACCCTCCGGTTAAGACAAAATTTGGATATCATATTATTATGGTTGAAGGGAGAAAATAAAACTATCGCAAGAC