Transcript asmbl_16924

Sequence
Transcript Sequence for observation asmbl_16924 of TGE0003793:
CCAGGCTCCTGCGGTGCTTCACAGTCTGGCTCCGGCGCCGCCCGTCGCGGTCTCGGTTCTGCTCAGCCCGCCTCTGCTCCTGCTCGGCGTCCGGGCTCCCTGTCCGCAGCCATGAACGCTCTCCTCCCGAGTCGAGCCCGCTGTCTTCTAGATTAGTCCCCGCTGCCGTCCCTGGACCGCCTGCACCATGGAGTCGCCCGCCTCGAGCCAGCCTGCCAGCATACCCCAGTCCAAAGGAAAATCTAAGAGGAAGAAGGATTTACGAATATCCTGTGTGTCCAAGCCACCTGTGCCCAACCCTACGCCACCCCGGAACCTGGACTCCCGGACCTTCATCACCATTGGAGATAGGAACTTTGAGGTGGAGGCTGATGACCTGGTGACCATCTCGGAACTGGGACGTGGAGCCTATGGGGTGGTAGAGAAGGTGCGGCATGCCCAGAGCGGCACCATCATGGCTGTAAAGCGGATCCGGGCCACTGTCAACACACAGGAGCAGAAGCGTCTGCTCATGGACTTGGACGTCAACATGCGTACAGTCGACTGCTTCTATACTGTCACCTTCTATGGAGCCCTCTTCAGAGAGGGAGATGTATGGATCTGCATGGAGCTCATGGACACATCCTTGGATAAGTTCTACCGGAAGGTGCTTGATAAAAACATGACGATTCCAGAGGACATTCTTGGGGAGATTGCTGTGTCTATTGTGAGGGCACTGGAGCATCTGCACAGCAAGCTGTCCGTGATCCACAGAGATGTGAAGCCATCTAATGTCCTCATCAACAAGGAGGGCCATGTGAAGATGTGCGATTTTGGGATCAGCGGCTACTTGGTGGATTCTGTGGCCAAGACGATGGATGCTGGCTGCAAGCCCTATATGGCTCCTGAGAGAATCAACCCGGAGCTGAACCAGAAGGGCTACAACGTCAAGTCTGATGTCTGGAGCCTCGGAATCACCATGATCGAGATGGCCATTCTACGGTTTCCTTATGAGTCTTGGGGGACCCCGTTCCAGCAACTGAAGCAAGTGGTGGAGGAGCCGTCCCCCCAGCTCCCAGCTGACCGTTTTTCCCCTGAGTTTGTGGACTTCACCGCACAGTGCCTAAGAAAGAACCCCGTGGAGCGCATGAGCTACCTGGAGCTGATGGAACATCCTTTCTTCACCTTGCACAAAACCAAGAAGACAGACATCACTGCTTTTGTGAAGGAAATCCTGGGAGAGGACTCATAGGGGGCAGGGCCTCGGACCCCACTCTGGCCCTCTAGTGCCCCACAGCCCCCTCTGCTGGAGCAGTGCTTGCCCACACCTATAAGCTACTGCCACCCTGGCCTTGGGCATTCCAAGAGGAATCGAGGGGGCTGCTCCCAAGTGCCAAAGAACCAGACTGTCGGGGCCCCCCGCTGGGCCCATGCGGGCCCCACCAGTGCCTCTGTCCTGCTGTTCCAAGTCTCCAGCCCTGAGGCCTTGGACTTGGAGGGGCCTGGATGCCCCTGCCAGACGCTGCTGCCCCTCACAGAAGGCATCCGGTGCTTGTGCACAGGCCACTGCCTTGGCCCAGCCCTGGATGCCACCTGAGTTGTATATTTTTGTATCTTTCGACTGAATGAACTTTGCACACTTCAAGGGTGGCCACACATCTCTCCCAGCATCAGTAGAGGGGACATGGGGATGAGCCACATGAGTCCTCCTGATCCCCCTCTGAGGGAGAAGCCAGAGCCACTTGAGGCCTTCACCCAGCACTGGCAAATGGCCTCTAAGGGGCACCAAGGACACTTAGCCTCTGCCTGCCACCTCTAGGGGTGTTGTTTCACTTTTTAAAAACAAATTTGTCTTTTTTTTTCTTTTGCTTTGTGGGTTTGGCTGGTTTTTCTCGCATGGTTTGGAGCCGATAACTTTTCTGCCACTCCCTAGGGGACCAGCAAGCTGAGACCCACCCTCTCCACTCAGGCTGGAGTCTAGGAGGATGAGCCCAAAGTCTCTGCTTAGAGAGGTATTCTTCTTGGGGATTGGCTTGACAGGGGCTATAGATTTGCTTTTGGTGTTAGAAAAGAAAAAAATGTTTTGAAGGACTACCTGTTCTGGGTTCTATCCCTGGTGGATTGGGGCAGTTACATGATTGCTGTTT