Transcript asmbl_16332

Sequence
Transcript Sequence for observation asmbl_16332 of TGE0026601:
CCTTGGAGGGCGCGGCGGCGGCGGCAGACGCGGTGCTCGGTCATGGGGTTCCAGCCGAGCCCAGGCCTCCTGGCCTCCCTGGGGGTGGGGCTGCTGACTCTGCTCGGCCTGGCTCTGGGCTCCTACTTGGTTCGGAGGTCCCGCCGGCCGCGGGTCACTCTTCTGGACCCCAATGAGAAGTACCTGCTGCGACTGCTGGACAAGACGACTCTGAGCCACAACACCACGAGGTTCCGCTTTGCCCTGCCCACCGCCCACCACGTTCTGGGGCTGCCTGTGGGGAGACACGTCTATCTCTCTGCCCGAATCGATGGCAGCCTGGTCATCAGGCCATACACTCCCGTCACCAGTGATGAGGACCAAGGCTACGTGGATCTCGTCGTCAAGGTGTATCTGAAGGGCGTGCACCCCAAATTTCCTGAGGGAGGGAAGATGTCTCAGTACCTGAACAGCCTGAAGATTGGGGATGTGGTGGAGTTTCGAGGCCCGAACGGGTTGCTCACTTACCTCGGGAAAGGGATTTTTAGCATTCAGCCCGACAAAAAGTCTCCAGCGGAGCCCCGTGTGGCCAAGAGCCTAGGGATGATTGCCGGTGGGACAGGTGCGTGTCGCCGGAGCCACCCTCCCGCCATTGCCGATGTTGCCATGAAAACTCGCAAGTGATCCTCGGAAGGTTTGGCAGTCATCGTCAGCAA