Transcript asmbl_16190

Sequence
Transcript Sequence for observation asmbl_16190 of TGE0003765:
GCTGTGCGCTGCCCTTGCTGCCTTTGGGTTCTTGAGAGCGAGCGCGTGAACGGCTCTCTGCAGTCTAGTCATGGCGCTTCACGTCCCCAAGGCCCCGGGCTTTGCCCAGATGCTCAAGGAGGGAGCGAAGCATTTTTCAGGATTAGAAGAAGCAGTGTACAGGAACATACAAGCTTGCAAGGAGCTTGCCCAAACCACTCGTACAGCGTATGGACCAAATGGAATGAACAAAATGGTTATCAACCACCTGGAGAAGTTGTTTGTGACAAATGATGCAGCGACTATTTTAAGAGAGCTGGAAGTACAGCATCCTGCTGCAAAAATGATCGTAATGGCCTCTCACATGCAAGAGCAAGAGGTTGGAGATGGCACCAACTTTGTTCTGGTGTTTGCCGGAGCTCTTCTGGAATTAGCGGAAGAGCTTCTTAGAATTGGCCTGTCAGTTTCGGAGGTCATAGAAGGTTACGAAATAGCCTGCAAAAAAGCCCATGAGATTCTTCCTGATTTGGTATGCTGTTCTGCAAAAAATCTTCGAGATATTGATGAAGTGTCATCTCTACTTCATACCTCCATAATGAGTAAACAGTATGGTAATGAAGTCTTTCTGGCCAAGCTTATTGCTCAAGCATGTGTATCTATTTTTCCTGATTCTGGCCATTTCAATGTTGATAACATCAGAGTTTGTAAGATTTTGGGCTCTGGTATCTCTTCCTCTTCAGTATTACATGGCATGGTTTTTAAGAAGGAAACTGAAGGTGATGTAACATCTGTCAAAGATGCAAAAATAGCAGTGTACTCCTGTCCTTTTGATGGCATGATAACAGAAACTAAGGGAACGGTATTGATAAAGACTGCTGAAGAGTTGATGAATTTTAGTAAGGGAGAAGAAAATCTTATGGATGCACAAGTCAAAGCTATTGCTGATACCGGTGCAAATGTCGTCGTAACAGGTGGTAAAGTGGCAGACATGGCTCTTCATTATGCAAACAAATACAATATCATGTTGGTGAGGCTGAACTCAAAATGGGATCTCAGAAGGCTGTGTAAAACAGTTGGTGCTACAGCTCTTCCTAGATTGACTCCTCCTGTGGTTGAAGAAATGGGACATTGTGACAGTGTTTACCTCTCAGAAGTTGGAGACACACAGGTGGTGGTTTTCAAGCATGAAAAGGAAGATGGAGCCATTTCTACCATAGTTCTTCGAGGCTCTACAGACAATCTGATGGATGATATAGAAAGGGCAGTAGATGATGGTGTTAATACTTTCAAAGTTCTCACAAGGGATAAACGTCTTGTACCTGGAGGTGGAGCAACAGAAATTGAGTTAGCCAAACAGATCACGTCATATGGAGAGACATGTCCTGGACTAGAACAGTATGCCATTAAGAAGTTTGCTGAGGCATTTGAAGCTATTCCCCGGGCACTGGCAGAAAACTCTGGGGTTAAGGCCAATGAAGTAATCTCTAAACTTTATGCAGTACATCAAGAAGGAAATAAAAATGTTGGATTAGATATTGAGGCTGAAGTTCCTGCTGTAAAGGACATGTTGGAGGCTGGTATTCTAGATACTTACCTGGGAAAATACTGGGCTATCAAACTGGCCACCAATGCTGCTGTCACTGTACTTAGAGTGGATCAGATCATCATGGCAAAACCAGCTGGTGGACCTAAACCTCCAAGTGGGAAGAAAGACTGGGATGACGACCAAAATGATTGAATGGTTAATTTTTACTGTAGGCAAAGGCTGTAGGTATAGTAGTACTCTAGGAATTGCCTGATCTTTTCCTATTCTTAAATTAAGAGGTGTTTTGTGTTTATATCCTTGGCTGGTTGATAAAATAAATGTGTTGTTACT