Transcript asmbl_14250

Sequence
Transcript Sequence for observation asmbl_14250 of TGE0003675:
CCGTTGTACCCACAAGCAGGTGACAAGTTCGTCTTCGCTACTAGACGATAAAGACAGCATTCAAGGAAGTCGTAAGGCAGCACGACTCCCCATCTTCCCATAGTAAAGATGGAGGCGCCCTGCATGTAAACGACAGGTAAAACTACTTCCGCCTTTCTCCTGCGCCCTCGTCCAAGATGGCGGACGAGGCCACCCGGCGTGTCGTGTCTGAGATCCCGGTGCTGAAGACTAACGCCGGACCTCGAGATCGGGAGTTGTGGGTGCAGCGACTCAAGGAGGAATACCAGGCTCTTATCCGGTATGTGGAGAACAACAAGAATGCGGACAATGATTGGTTCCGACTGGAGTCCAACAAGGAAGGGACTCGGTGGTTTGGAAAATGCTGGTACATCCACGATCTCCTCAAATATGAGTTCGACATCGAGTTTGACATTCCTATCACATATCCTACTACTGCTCCAGAAATTGCAGTCCCTGAGCTGGATGGAAAAACAGCAAAGATGTACAGGGGTGGCAAAATATGTCTGACCGATCATTTTAAGCCTTTGTGGGCCAGGAACGTGCCCAAGTTTGGATTAGCTCATCTTATGGCTCTGGGGCTGGGTCCATGGCTGGCAGTGGAAATCCCCGATCTAATTCAGAAAGGCGTGATTCAGCATAAAGAGAAATGCAGCCAATGAAGGATCAAGCCGCTGAGGCTGAGACTTGGATAGGCTACGTTCCTGTTTTCCTGTGCATCCCTCTTCTTACTCATCCGACCGCTTCACTCACACCCCTTCGCCTACAGCGGTTACTAAGTAGCTGCAGCGGTACAGTTTCCAGCATTGCCGGGGTGAAAAAACAGTGTTGCTACTGAGTTTCTAAGTTAGGCTGTACAGGGAGGGGAGAGGCTGGGGCTTTGGAAAAACCGAAAGGTAATTTATACCCCTTCCCCAGGCGGAGCGGTGTGAGATCCTGGAAGGACAGGGGATGGTTGAAAGTGGGTACACAGTCTTTTTGGTTTCCGGAAATAACTCATCAATAAAAGCTGCTTCTTCTGGT