Transcript asmbl_14214

Sequence
Transcript Sequence for observation asmbl_14214 of TGE0003665:
AGCTGCAGAAACGGCGCGGCTGTTCCCACAAAGCGTGGCTAGCGGAGCGCCATGAGCAGAGCACCCAGCGATCTCAAGCTCAGGCTGGCCCGGGCTGGGCAGGAGCACCTGCTGCGGTTCTGGGATGAGCTGGAAGAGGCCCAGCGGGCGGAGCTCTGTGCGGAGCTCCAGGCCATGGACTTCGAGGAGCTGAGCATCTTTTTCCAGAAGGCCACCGAAGGAGTCCACCAGTTCTCTCAGCTGGAGAAGGTGGATGCGCGGATGGAGCCTATCCCTCGGGAAGTGCTGGGCAGCGCTACGCGGGATCAAGATCAGCTCCAGGCCTGGGAAAGTGAAGGACTTTTCCAGATTTCTCAGAACAAAGTGGCTGTTCTTCTTCTAGCTGGCGGACAAGGGACAAGACTTGGTGTCTCGTATCCCAAGGGGATGTACGATGTTGGGTTGCCATCTCATAAGACACTTTTTCAGATTCAAGCAGAGCGGATCCTGAAGCTTCAGCAGTTAGCTGAAAAATACCATGGCAACAAGTGCACCATCCCGTGGTATATAATGACGAGCGGCAGAACAGTGGAGTCCACAGAGGAATCCTTCACCAGACACAAGTACTTCGGTTTGAAAAAGGAGAATGTGATCTTTTTTCAGCAGGGAATGCTACCAGCCATGAGTTTTGATGGGAAAATTATTTTGGAAGAGAAGAATAAGGTTTCTATGGCTCCAGATGGAAACGGTGGTCTTTACCGGGCTCTTGCGGCCCAGAACCTCGTGGAGGATATGGAGCAGAGAGGCGTCGAGAGTGTTCACGTGTACTGCGTCGACAACATTCTGGTCAGAGTGGCGGACCCCCGGTTCATCGGATTCTGCATTCACAAGGGAGCAGACTGTGGGGCGAAGGTGGTGGAGAAGACGAACCCCACGGAGCCGGTGGGCGTGGTGTGCCGGGTGGACGGCGTGTACCGCGTGGTGGAGTACAGCGAGATCTCCCTGGCCACCGCGCAGCGGCGGGGCCCCGACGGGCGGCTGCTGTTCAGCGCGGGCAACATCGCCAACCACTTCTTCACCGTGCGGTTCCTGAGAGACGTGGTCAGTGTTTATGAACCTCAGTTGCAGCACCATGTGGCTCAAAAGAAGATTCCATTTGTGGATCCCCAGGGGCAGTTAATTAAGCCAGACAAACCAAATGGAATAAAGATGGAAAAGTTCGTCTTCGACATCTTCCAGTTTGCAAAGAAGTTCGTGGTGTATGAGGTGTTACGGGAAGACGAGTTCTCCCCACTCAAGAACGCGGACAGTCACAGTGGCAAGGACAACCCCACCACGGCCAGGCACGCTCTGCTGTCCCTTCACCACCGCTGGGTGCTCAACGCGGGGGGCCACTTCGTAGACGGAAATGGCTCCCGCCTGCCCGCGATTCCCTGCTTGAAGGATGCCCACGACGTCCCTATCCAGTGCGAGATCTCCCCTCTCGTCTCCTACGCCGGAGAGGGACTAGAAAGTTACGTGGCCGGCAAAGAATTCCACGCGCCTTTAATCATTGGCGAGAATGGCGTCTGTGAGCTGGTGAAGGACGGCGTATGAGCCAGGTGCCAAGTTCCCCGCAGCGAGAGCAGCGCTTACGTGTGACAGACCAACTGTGAGCCTCCAGGCCCCTCCTGAGGCTACTCAAGTTCGAATGTCCACGAGTCTCCTTCTGCCTGTCGAACTCTCCTAACTACTACGTAGCCCCTGAGAAGCAGCGGCCTGAACTGCAGAGAGCACCGTTAAGGTTCTCAACTCACTGACGGTCTTATTTATAGTTTTCAGTTGTATAAAATTTTCCCCAGGCCAAGGACAGCAGTGCCACCCACGCAGTTCCCTGCAGCGTGAGGGTGGCCAGGCGTGCGCCCGCCCTTCGCCTGGGGCTAGAAGCTTGTCTTCAGAGTTCTTCGGGGTGACAGTACGCCCTTGTACATGTCAGAAGGTTTCTGCGATACTACAAGTTTGTTTTATTTTATCAAAAGTAAGCTTTTTCAAGAAAATAATTGGACAGTAAAATAAACTTTTCTTTTTGTCTCTGG