Transcript asmbl_17050

Sequence
Transcript Sequence for observation asmbl_17050 of TGE0000381:
TTCCGAACTGCGCATGCGCCACCGCGTCTGCAGGGGGAGAAGCGGGCAGGGGCGCAGGCGCAGTAGTGTGATCCCCTGGCCAGTCCCTAAGCACGTGGGTTGGGTTGTCCTGCTTGGCTGCGGAGGGAGTGGAACCTCGATATTGGTGGTGTCCATCGTGGGCAGCGGACTAATAAAGGCCATGGCGCCAGCAGAAATCCTGAACGGGAAGGAGATCTCCGCGCAAATAAGGGCGAGACTGAAAAATCAAGTCACTCAGTTGAAGGAGCAAGTACCTGGTTTCACACCACGCCTGGCAATATTACAGGTTGGCAACAGAGATGATTCCAATCTTTATATAAATGTGAAGCTGAAGGCTGCTGAAGAGATTGGGATCAAAGCCACTCACATTAAGTTACCAAGAACAACCACAGAATCTGAGGTGATGAAGTACATTACATCTTTGAATGAAGACTCTACTGTACATGGGTTCTTAGTGCAGCTACCTTTAGATTCAGAGAATTCCATTAACACTGAAGAAGTGATCAATGCTATTGCACCCGAGAAGGATGTGGATGGATTGACTAGCATCAATGCTGGGAAACTTGCTAGAGGTGACCTCAATGACTGTTTCATTCCTTGTACGCCTAAGGGATGCTTGGAACTCATCAAAGAGACAGGGGTGCCGATTGCCGGAAGGCATGCTGTGGTGGTTGGGCGCAGTAAAATAGTTGGGGCCCCGATGCATGACTTGCTTCTGTGGAACAATGCCACAGTGACCACCTGCCACTCCAAGACTGCCCATCTGGATGAGGAGGTAAATAAAGGTGACATCCTGGTGGTTGCAACTGGTCAGCCTGAAATGGTTAAAGGGGAGTGGATCAAACCTGGGGCAATAGTCATCGACTGTGGAATCAATTATGTCCCAGATGATAAAAAACCAAATGGGAGAAAAGTTGTGGGTGATGTGGCATACGACGAGGCCAAAGAGAGGGCGAGCTTCATCACTCCTGTTCCTGGCGGCGTAGGGCCCATGACAGTTGCAATGCTCATGCAGAGCACAGTAGAGAGTGCCAAGCGTTTCCTGGAGAAATTTAAGCCAGGAAAGTGGATGATTCAGTATAACAACCTTAACCTCAAGACACCTGTTCCAAGTGACATTGATATATCACGATCTTGTAAACCGAAGCCCATTGGTAAGCTGGCTCGAGAAATTGGTCTGCTGTCTGAAGAGGTAGAATTATATGGTGAAACAAAGGCCAAAGTTCTGCTGTCAGCACTAGAACGCCTGAAGCACCGGCCTGATGGGAAATACGTGGTGGTGACTGGAATAACTCCAACACCCCTGGGAGAAGGGAAAAGCACAACTACAATCGGGCTAGTGCAAGCCCTTGGTGCCCATCTCTACCAGAATGTCTTTGCGTGTGTGCGACAGCCTTCTCAGGGCCCCACCTTTGGAATAAAAGGTGGCGCTGCAGGAGGCGGCTACTCCCAGGTCATTCCTATGGAAGAGTTTAATCTCCACCTCACAGGTGACATCCATGCCATCACTGCAGCTAATAACCTCGTTGCTGCGGCCATTGATGCTCGGATATTTCATGAACTGACCCAGACAGACAAGGCTCTCTTTAATCGTTTGGTGCCATCAGTAAATGGAGTGAGAAGGTTCTCTGACATCCAAATCCGAAGGTTAAAGAGACTAGGCATTGAAAAGACTGACCCTACCACACTGACAGATGAAGAGATAAACAGATTTGCAAGATTGGACATTGATCCAGAAACCATAACTTGGCAAAGAGTGTTGGATACCAATGATAGATTCCTGAGGAAGATCACGATTGGACAGGCTCCAACGGAGAAGGGTCACACACGGACGGCCCAGTTTGATATCTCTGTGGCCAGTGAAATTATGGCTGTCCTGGCTCTCACCACTTCTCTAGAAGACATGAGAGAGAGACTGGGCAAAATGGTGGTGGCATCCAGTAAGAAAGGAGAGCCCGTCAGTGCCGAAGATCTGGGGGTGAGTGGTGCACTGACAGTGCTTATGAAGGACGCAATCAAGCCCAATCTCATGCAGACACTGGAGGGCACTCCAGTGTTTGTCCATGCTGGCCCGTTTGCCAACATCGCACATGGCAATTCCTCCATCATTGCAGACCGGATCGCACTCAAGCTTGTTGGCCCAGAAGGGTTTGTAGTGACGGAAGCAGGATTTGGAGCAGACATTGGAATGGAAAAGTTTTTTAACATCAAATGCCGGTATTCCGGCCTCTGCCCCCACGTGGTGGTGCTTGTTGCCACTGTCAGGGCTCTCAAGATGCACGGGGGCGGCCCCACGGTCACTGCTGGACTGCCTCTTCCCAAGGCTTACATACAGGAGAACCTGGAGCTGGTTGAAAAAGGCTTCAGTAACTTGAAGAAACAAATTGAAAATGCCAGAATGTTTGGAATTCCAGTAGTAGTGGCCGTGAATGCATTCAAGACGGATACAGAGTCTGAGCTGGACCTCATCAGCCGCCTTTCCAGAGAACATGGGGCTTTTGATGCCGTGAAGTGCACTCACTGGGCAGAAGGGGGCAAGGGTGCCTTAGCCCTGGCTCAGGCCGTCCAGAGAGCAGCACAAGCACCCAGCAGCTTCCAGCTCCTTTATGACCTCAAGCTCCCAGTTGAGGATAAAATCAGGATCATTGCACAGAAGATCTATGGAGCAGATGACATTGAATTACTTCCCGAAGCTCAACACAAAGCTGAAGTCTACACGAAGCAGGGCTTTGGGAATCTCCCCATCTGCATGGCTAAAACACACTTGTCTTTGTCTCACAACCCAGAGCAAAAAGGTGTCCCTACAGGCTTCATTCTGCCCATTCGCGACATCCGCGCCAGCGTTGGGGCTGGTTTTCTGTACCCCTTAGTAGGAACGATGAGCACAATGCCTGGACTCCCCACCCGGCCCTGTTTTTATGATATTGATTTGGACCCTGAAACAGAACAGGTGAATGGATTATTCTAAACAGATCACCATCCATCTTCAAGAAGCTACTTTGAAAGTCTGGCCAGTGTCTATTCAGGCCCACTGGGAGTTAGGAAGTATAAGTAAGCCAAGAGAAGTCAGCCCCTGCCCAGAAGATCTGAAACTAATAGTAGGAGTTTCCCCAGAAGTCATTTTCAGCCTTAATTCTCATCATGTATAAATTAACATAAATCATGCATGTCTGTTTACTTTAGTGACGTTCCACAGAATAAAAGGAAACAAGTTTGCCA