Transcript asmbl_14043

Sequence
Transcript Sequence for observation asmbl_14043 of TGE0003645:
CGAGAAGGTGGTGGAAGAAGATGGCGGTGCTAGGGCCGAGTTTACAATCTTTTTGAATAGACTAGTCCAGTAACTGTTCGGGTCATGGCGTCAAACTCAACTAAGTCTTTCCTGGCAGATGCAGGCTATGGAGAACAGGAGCTGGATGCTAACTCTGCCCTTATGGAATTAGACAAAGGTCTGAGATCTGGCAAACTTGGTGAACAGTGTGAAGCAGTTGTTCGCTTTCCCAGGCTCTTTCAGAAGTATCCATTCCCTATTCTCATCAATTCTGCATTCCTAAAGTTAGCTGATGTTTTCAGAGTTGGAAACAATTTCCTGAGGCTCTGTGTTCTTAAAGTTACTCAACAAAGTGAGAAGCATTTGGAGAAAATTCTAAATGTGGATGAATTTGTGAAGAGAATTTTCTCTGTGATTCATAGTAATGATCCTGTAGCAAGAGCCATCACACTCCGCATGTTGGGAAGTCTGGCATCAATAATTCCTGAAAGGAAGAATGCTCACCATAGTATTCGTCAGAGTCTGGATTCACATGATAACGTAGAAGTTGAAGCTGCTGTTTTTGCTGCTGCAAACTTCTCTGCACAGTCAAAGGATTTTGCTGTAGGAATCTGTAACAAAATCAGTGAAATGATTCAAGGCTTAGCCACACCAGTAGACTTGAAGCTAAAGTTGATCCCAATCCTACAGCACATGCACCACGATGCGATCCTGGCTTCCAGCGCTCGTCAGCTGTTACAACAGCTAGTCACGTCCTATCCTTCTACCAAAATGGTGATTGTTTCTTTGCACACTTTTACTCTGCTTGCAGCTTCATCTTTGGTGGATACACCTAAGCAGATTCAGCTTCTCTTACAGTATTTGAAGACTGACCCCAGGAAAGCAGTAAAGAGACTTGCTATTCAAGATCTGAAATTACTTGCCAATAAAACACCGCATACTTGGACTAGGGAAAACATTCAGGCACTCTGTGAATGTGCCCTCCAGACTCCTTATGACAGCTTAAAACTCGGGATGTTGTCTGTCCTTTCCACACTGTCAGGGACTATCGCTGTCAAACATTACTTCAGCATAGCTTCGGGAAATGTGGGTTCTTCGCCTAGATCCTCTGATTTAGTCAAATTAGCCCAAGAGTGCTGTTACCATAATAACAGGGGCATTGCAGCTCATGGAGTCAGAGTACTAACTAATATAACTGTTTCTTGTCAAGAAAAAGACCTTTTGGCACTGGAACAAGATGCTGTTTTTGGCCTGGAAGCCCTTCTGATACTTTGTAGTCAAGACGATAGTCCAGGTGCTCAAGCCACTTTAAAGATTGCTCTGAACTGTATGGTGAAGCTGGCCAAGGGCAGACCCCATCTTAGCCAGTCAGTGGTTGAGACCTTGTTGACTCAGTTGCACAGTGCTCAGGATGCTGCCCGGATCCTGATGTGCCATTGCCTGGCTGCCATTGCCATGCAGCTGCCGGTGCTGGGTGATGGAATGCTGGGTGACCTCGTGGAACTCTACAAGGTGATTGGACGATCAGCCACAGACAAGCAGCAGGAACTTCTGGTGAGTTTGGCCACTGTGATTTTTGTCGCCAGTCAGAAAGCACTCTCTCCTGAGGTAAAGGCAGTAATTAAACAGCAGCTCGAAAGTGTCTCCAATGGGTGGACTGTGTACCGAATCGCCAGACAGGCATCCAGAATGGGTAATCATGACATGGCCAAAGAGCTTTATCAGAGTTTGCTGACTCAGGTTGCCTCAGAACATTTCTACTTCTGGCTGAATAGTTTGAAGGAGTTCTCACATGCAGAACAGTGTCTCACTGGATTGCAAAAGGAAAATTATAGTTCAGCACTTTCTTGCATTGCTGAGTCTTTAAAATTCTACCACAAAGGGATTGCATCCCTAACGGCTGCCAGTACACCACTGAATCCTTTAAGTTTTCAGTGTGAATTTGTAAAACTCAGGATTGACCTTCTACAAGCCTTCTCGCAACTTATCTGTACTTGTAATAGCCTAAAGACAAGCCCCCCACCTGCAATTGCCACAACAATTGCCATGACCTTAGGGAATGACCTTCAGAGGTGTGGTCGCATCTCCAATCAGATGAAACAGTCCATGGAAGAATTCCGAAGCCTTGCTTCCCGATATGGAGATCTTTATCAGGCATCTTTTGATGCCGATTCAGCAACTTTGAGAAATGTAGAGCTACAGCAGCAGAGCTGTTTGCTGATATCTCACGCAATAGAAGCTCTGATTTTGGACCCGGAATCTGCAAGTTTCCAGGAATATGGATCTACTGGAACAGCCCATGCTGATAGTGAATATGAGAGAAGAATGATGTCTGTGTATAATCATGTCTTGGAGGAGGTGGAATCACTCAATCGGAAATATACCCCTGTTTCTTATATGCATACAGCATGCCTCTGCAATGCCATCATTGCTTTGCTGAAAGTTCCTCTTTCATTTCAGAGATATTTTTTCCAGAAACTGCAGTCTACCAGCATTAAGCTTGCTCTGTCACCATCCCCACGGAACCCTGCAGAGCCCATCGCTGTCCAAAATAACCAGCAGCTGGCGCTGAAGGTGGAGGGAGTGGTTCAGCATGGATCCAAACCAGGACTTTTTCGCAAAATTCAGTCTGTCTGTCTGAATGTTTCTTCCACGCTACAGAGTAAATCTGGACAAGACTACAAGATACCCATCGACAATATGACCAATGAGATGGAGCAGAGGGTTGAGCCTCATAATGATTACTTTAGTACTCAGTTTCTGTTGAACTTTGCTATCCTTGGAACACACAATATTACAGTGGAATCTTCAGTGAAAGACGCCAATGGTATTGTATGGAAGACTGGTCCCAGAACTACCATATTTGTCAAATCCCTGGAAGACCCTTATTCCCAGCAAATCCGCCTACAACAGCAGCAAGCCCAGCAGCCATTACAACAGCAGCAGCAACGGAATGCCTACACGCGATTTTAGCCACGTGACGAGTGTACTACAGGCTTTACAGGAATCGATGAAATTGTCAAAAATAGTTTGCTTTTCCACATGGATTAAGATATGAAAGTTTTAACGCAGACTCTGTTTACTCATTGGTTTCTGCAATGTAATCTGAAAAATGATTTTTTTTACCTTAAAAATTTCATTCGAGAGATATTTGGGTTACTAACCAGAAAGATTTTTTTCCCTTGTTCCTTTAACCAAGTCCTTTATCTCATATTTAACATTTTCATTCTTTTATTAGTGTTTTTACTGCTGCTGAGCCTTTTCTTTTTCTTTCAAGAAAAGTCACATATTGGGATCACTGAATTAGTAAATTTGACTGTTTCTCTACCAAAATATACTACTTGCTGCTTGACACAGGCCTGTAATTCTGAGCTATGCCTTGGGGAGTTCTGACCAGTAGGGTACAGGGTTCACCCGTAGTAGAAGAAACTGAGTCTTCCCGTGGGTGGACTTAGAAATGTCCCCTGAAACGTCCAGTTTCTGGGTTACGAGAGCAGGCAGTCTAGCAGAATTGAGACATCCTGCTATACATATTATTTCAACTACTTACCTATCTGTTCTGTGCTAAAGCAATCTTAATTTATTGTTTTAGTATTTAATTGACCCAAAGAGCAGCTAGCAATTACATAGGAAGATTTGGAGATTAATAATTTTTTTTTTATTATGCGTGTGATTGTGTAGACTTTGTACATTGTTTCTAAGAGTGAAAAAAATCACTCACATTTAATATCTTATTGTTTTAAGGTAGGAGGGCAGATCTTTTCCTTTGATTGATTTAGTTTCTTCTTGGCAAGTTCTGTAACGCTAGACTTGATTGTCTAGAAAGGACCGTCTCCTTATAACCAACCTCAATTAGTTGAGATGCTCAGGGAATAGAAGTTTTCTGGTTAGCCAGAAAACTCCTTTTTTCTATTTCAATACTGGCTGAAAACCATTGTAAAATCTAATAATAGTATGCTTTCTTGTCTTAACACAGTGCAGTAGATAAAATTTAACTATTCTTTCTTGATTTGGGATCAGTCAGTGCTTTGGGATCATGATTTCTAAACATCAGGGATCACAGATTGCAGATATCGATGATATGGTCACTTAGGCTGGAATCAGCTCTGAATGTGAAGCAGACACATTCCTTGGAAGTTTCTTTTTAAAATAAATCTCTCAATTTCA