Transcript asmbl_13710

Sequence
Transcript Sequence for observation asmbl_13710 of TGE0003620:
GGGCAGGAGGAAGGGGTGCGGTCGCAGTCGCGGTCACGGTCGCGGGCCGGGAACGAGCTCCGAACACCAGCCCGCGAGGCCGCACACCTGTCTGGCTGTTCTGCCGCACACCAGTCCCCGCAGCCTCGCTTCAGGGTTAGTGTGACCTGAACTTAAGGCAAAGGTGGTATATCATGGCATCTCTCTGGGTTGGACACCGAGGGACAGTGCGAGATTATCCAGGCTGTAGCCCATCAGTGGATGCTGAAGCGATTCGTAAGGCAATCAGAGGAATTGGAACTGACGAGAAAACACTCATCAGCATTCTAACTGAGAGGTCAAACGCACAGCGGCAGCTGATTGTTAAGGAATATCAAGCAGCGTATGACAAGGAACTGAAAAATGACTTGAAGGGCGACCTCTCTGGCCACTTTGAGCATCTCATGGTGGCCCTCGTGACTCCTCCAGCAGTGTTTGATGCGAAGCAGCTGAAGAAATCCATGAAGGGCACTGGAACAAATGAAGATGCATTGATTGAAATCTTAACCACCAGGACAAGCAGGCAGATGAAAGAGATCTCTCAAGCCTACTACACAGTATATAAGAAGAGTCTTGGAGATGACATTAGTTCTGAAACATCTGGTGACTTCCGGAAAGCTCTGTTGACTTTGGCAGATGGCAGAAGAGATGAAAGTCTGAAAGTAGATGAGCATTTGGCCAAAAAAGATGCCCAGATTCTCTATAATGCTGGTGAGAACAGATGGGGCACGGACGAAGATAAATTCACTGAGATCCTATGTTTAAGGAGCTTTCCTCAACTAAAACTAACATTTGATGAATACAGAAATATTAGCCAGAAGGACATTGAGGACAGCATAAAAGGAGAATTATCTGGGCATTTTGAAGATTTGCTGCTGGCCATAGTTCATTGTGCAAGGAATATGCCTGCCTTTTTAGCTGAAAGACTACATCAAGCTTTGAAGGGTGCTGGAACTGATGAGTTCACTCTGAACCGAATAATGGTTTCCAGATCAGAAATTGACCTTTTGGACATTCGAGCAGAGTTTAAGAAGCAGTATGGCTACTCCCTAAATTCAGCAATTAAATCGGATACTTCTGGAGACTATGAAATCACACTCTTAAAGATCTGTGGAGGAGATGACTGAGTCAAGAACATCATCTCCAAAGGTTGTTTGCTTCCATGATGGGCTTCTCCAACAGCTCTGCTTACTTCTCTTTCACGGGATTTAAAAGTACAAGAAGTATAAACAGCAATCTGTTTTTCGTAACAGAAATTGTCATTGTTCCATAACAACAACAAAGTGATTATCTTAAAGTATTTCATCATAATGTAGTAGTTTATAAGTGAAAATTTAAAATGGTATAAAGAATCCGCTAATACTCTCCAAATTATATTTCTACTTAGGAAGTGAGAATCATTGTACAGTTCTAAAACATTAAATGCAAAAACAAGGTAATAAAAGTTGTCACCTTTGTTAAA