Transcript asmbl_13387

Sequence
Transcript Sequence for observation asmbl_13387 of TGE0003610:
GTCGACAGGGCAAAGGACTCAGGTGCAGGCTTCCCTAACGGACTAGTCTCGCACCTAAAGAAGAAAGAAAATGGCCTGTGCCGAGTATTCTTTTCATGTGCCGAGTCTAGAGGAGCTTGCTGGAGTTCTACAGAAGGGACTAAAGGATAACTTTGCTGACGTCCAGGTTTCTGTAGTTGATTGCCCTGATTTGACTAAAGAGCCATTTACCTTTCCTGTGAAAGGCATCTGTGGGAAAACTAGAATTGCAGAAGTAGGAGGTGTGCCTTACTTATTGCCTCTTGTAAATAGAAACAAAGTCTATGATCTAAATAAGATTGCAAAAGAAATCAAGCTTCCTGGAGCTTTTATTCTTGGAGCGGGGGCAGGCCCATTTCAGACTCTCGGGTTCAATGCTGAGTTTATGCCAATTGTTCAAACAGAAAGTGAACACAAACCTCCTGTGAATGGAAGTTACTTTGCCCGTGTTAACCCTGCAGATGGAGGATGCTTACTAGAGAAATACAGTGAGAAATATCGTGATTTTGGGTGTGCATTACTGGCTAATCTTTTTGCCAGTGAGGGCCAACATGGAAAGGTCATTGAGGTGAAAGCCAAAAGAAGAACTGGAAAACTTAACTTTGTGACTTGTATGAGACAGACTCTTGAAAAACATTATGGAGATAAGGCTGTAGGGATGGGAGGTACTTTCGTAATTCAGAAGGGAAAAGTGAAGACTCACATTATGCCTGCAGAATTTCCTTCCTGCCCTTTGAACTCTGAGGAAAAGGTGAATGAATGGTTGAATTTTTATGAGATGAAGGCTCCTTTGATTTGTCTGCCAGTTTTTGTCTCCAAAGACCCAGGATTTGATTTGCGATTGGAGCACACTCACTTTTTCAGTCATCATGGAGAAGGTGGACACTACCATTATGACATTACCCCAGATATAGTAGAATATCTTGGCTACTTCTTACCTGCGGAGTTTCTTTATCGCATTGATCAACCAGAAGAGACCCATTCATATGGGCGAGATTAAATCAACTGATCAGCATTTAGAAAAAGAAGTGATTAACTAAAGTTAATTAAATGATTAACTCATTAATTGCTACAAATATAAAGTTCAATAGAAATGATCTTACTACTTAAACCCTATTTTTTTGGCCTTTGAAATGAAAGGTATGTTGACATTACTCTGTTATTTCATAGATCTGAAAAAGTTTCTTGGGAACAAAGATATATAATGGAGATGTTCTTCATTATTTTTTTATTCTAAAAATCAGTCTTATATTTATACCTTAAATATAAACATGATCTGGAATCATGTGATTGGTTAATTTTACTAACAGTAATAATTTACACTTAACATTATTAATTTTTTCAAATTAGTCTCACAACTGCTAATTGGGTATTTCTGGGTACTAGAAAAATCAGTGTTGGAAATTTTGATAGTTGTTGAATCTTTGTATTGAATTTTAAAAGTCTATTTTAGGAGTCAGAGTACACTTTTTTCATGGAATAAGGTGATCAGAAGGAGCAACTTTACCCCTTTTGGTGAAGTTGAACCATACTCAGAGTTTGCAGTTTGCCTTGTACAAACATTAGCAACTAGACAGTTAGCCATGATTCCTCTTTTGTTTGGATCGCCAACTGGAAGCAGTTTGTACCTTATTAGTTATTTGGAAGAAGAAAGCGGGGAAAAGAAACAGCATCAAAATACAACACTGAAGTGAGTATAATTTCTAAGTGAGGCTGTTGTTACACATGACCACTGTCCTTTGTGAAATATAAAATTATATTTGAATACATTTGTTACTGGTTATAATGGTTGAAATTTTCTTCAGTGTTCTTCTGTAATAATCATTAGTAAGAAATCAACTGTAATCTTATTAATGCCAACAATGTGCAGATTTAGGAGCTCTTCAGTACTAAGCACATAATAAATCAAAAAATATTATTTGATTGTCTTCTCTGGATGTAAGCTATAACATATCCTTTGAGTATAAATTTTAAAATATTTTTAAATAAGTACTAGTTTGTAGCAAAAGAATGAATAAAATTTTAAAATTCAC