Transcript asmbl_13271

Sequence
Transcript Sequence for observation asmbl_13271 of TGE0003604:
GCGCGCGGCATCATGAGCAGCAAAGTCTCTCGCGACACCCTCTATGAGGCTGTGCGGGAAGTCCTGCACGGGAACCAGCGCAAGCGCCGGAAGTTTTTGGAGACGGTGGAGCTGCAGATCAGCTTGAAGAACTATGATCCTCAGAAGGACAAACGCTTCTCTGGCACCGTCAGGTTGGCACCGTTCTGACCCCACCCAGCACTCAGTGCCCCCCGTGCCCTGCTACTCTCTTGAGGCTCCTTTTGAGCCCTTGATGGGCAGGCACGTGCTGCACTGAAGTGCCCGGGTAGTTCAGACCCTCTGCTTTGGGCAGGTGCGGCTGGACGGACCCCCACCCTGGGTCTTAAAACAAGAGGGGAGGCGTGGGGAGGCCTTGGCCGAGCCCGCCGGCTAGTTTGAGAAGCCAGACTAGCTGTTGGTGAATGTGAACGCTCTGGGTAAGGCTCAGTGTCTGCAGCGGTCCCAGACCCGTTCACCTGCCCTTCGGACCCAGGGCTGGACATGACCTGTTCTGTCCCCAAAATGCAGGCTTAAGTCCACTCCCCGCCCAAAGTTCTCTGTATGTGTTCTGGGGGATCAGCAGCACTGCGATGAGGCCAAGGCTGTGGATATTCCCCACATGGATATCGAGGCATTGAAAAAACTCAACAAGAATAAGAAACTGGTCAAGAAGCTAGCCAAGAAGTATGATGCCTTTTTGGCTTCAGAGTCTCTGATCAAGCAGATCCCACGAATCCTGGGCCCAGGCCTGAATAAGGCAGGCAAGTTCCCTTCCTTGTTGACCCACAATGAGAACATGGTGGCCAAAGTCGATGAAGTGAAATCCACAATCAAGTTCCAGATGAAGAAGGTGCTATGTCTAGCAGTGGCCGTTGGCCACGTGAAGATGACAGATGATGAGCTTGTGTATAACATCCACTTAGCTGTCAATTTCTTGGTGTCATTGCTCAAAAAGAACTGGCAGAACGTCCGGGCTTTATACATCAAGAGCACCATGGGCAAGCCCCAGCGCCTGTACTAAGGCACAGCTTAATAAACCATACTGTTACCATT