Transcript asmbl_12910

Sequence
Transcript Sequence for observation asmbl_12910 of TGE0003597:
CGGTCGTCGTCGGGGGTGGTAGCGGCAGAGGGGGCGGCGGCAGTGGCAGCATTGGGGACGGCAGCCGTGAAGGCGACGGTGGCGCAGGGCCGGGGACGGGGGGAATGAGGAGGCCGCGGCGGGCCAGCGGCGGAGCTGTGTAGCGGATAAGCGGCTCCCCCTCCTTCCCTTGGTTGAGTCGGGGGCGCGCGCGCGAGCGCGCGGCCGTCCGGAACGGGCTTCCCACCCTCCACTCCCGCGACCCGCACGGCACCCCCACCCGGGCCCGGAGGATGATGAAGCTCAAGTCGAACCAGACCCGCACTTATGACGGCGACGGCTACAAGAAGCGGGCCGCGTGCTTGTGTTTTCGCAGCGAGAGCGAGGAGGAGGTGCTACTTGTGAGCAGTAGTCGCCATCCCGACCGATGGATTGTCCCTGGAGGAGGAATGGAGCCAGAGGAGGAGCCAAGTGTGGCAGCAGTCCGTGAAGTCTGTGAGGAGGCTGGAGTAAAGGGGACATTGGGAAGATTAGTCGGGATTTTTGAGAACCAGGAAAGGAAGCACAGAACATATGTCTATGTGCTCATTGTCACGGAAGTGCTGGAAGACTGGGAAGATTCAGTTAACATTGGAAGGAAGAGGGAGTGGTTTAAAATAGAAGATGCCATAAAAGTGCTGCAGTATCACAAACCGGTGCAGGCGTCGTATTTTGAAACATTGAGGCAAGGCTACTCAGCCAACAATGGCACCCCGGTCGTGACCACCACATACTCAGTTTCTGCTCAGAGCTCTATGCCAGGCATCAGATGACTGAAGACTTCCTGTAAGAGAAATGGAAATTGGAAATTAGACTGAAGTGCAGATCTTCCCTCTCACTCTTGCTCTTTTCACCTCTCTTCACAGGCCTCCTCTTTCAAATAAGGCATGACGGGCAGCAGAGGAAGGGTTTATTGATAATGTTCCTGTTTGGTGTTAAGTGATGGGGCTTTTTCTTCTCGTTTTTTTTTGAGGGGGGTGGGGGTTGGGTATGTAATTTGTAAGTACTTTTGTGCATGATCTGTCCCTCCCTTTTCATACCTCTACAATTCTCTAAAAAGAGGCAGACAGCCTTCCCTTTGCCTTGGATTCTGAAGTATTCCTCTTTGTCTCATCCCATCCCTGGCCAGACATTTTTCTTTGATTTTTAATTTTTTTAAATTAAAAGCTACCAATATGAGATAAAAACTTTCAAGAATTTGTTCTGTAATGTGCTGTTCAGTCCAGTAGGTTGGTCAGTTTCACTGCAGAATACATTTATCTACACATTATATACTGGGC