Transcript asmbl_14293

Sequence
Transcript Sequence for observation asmbl_14293 of TGE0003765:
GCTGCCTTCCCAGGAGGCTGTGCGCTGCCCTTGCTGCCTTTGGGTTCTTGAGAGCGAGCGCGTGAACGGCTCTCTGCAGTCTAGTCATGGCGCTTCACGTCCCCAAGGCCCCGGGCTTTGCCCAGATGCTCAAGGAGGGAGCGAAGCATTTTTCAGGATTAGAAGAAGCAGTGTACAGGAACATACAAGCTTGCAAGGAGCTTGCCCAAACCACTCGTACAGCGTATGGACCAAATGGAATGAACAAAATGGTTATCAACCACCTGGAGAAGTTGTTTGTGACAAATGATGCAGCGACTATTTTAAGAGAGCTGGAAGTACAGCATCCTGCTGCAAAAATGATCGTAATGGCCTCTCACATGCAAGAGCAAGAGGTTGGAGATGGCACCAACTTTGTTCTGGTGTTTGCCGGAGCTCTTCTGGAATTAGCGGAAGAGCTTCTTAGAATTGGCCTGTCAGTTTCGGAGGTCATAGAAGGTTACGAAATAGCCTGCAAAAAAGCCCATGAGATTCTTCCTGATTTGGTATGCTGTTCTGCAAAAAATCTTCGAGATATTGATGAAGTGTCATCTCTACTTCATACCTCCATAATGAGTAAACAGTATGGTAATGAAGTCTTTCTGGCCAAGCTTATTGCTCAAGCATGTGTATCTATTTTTCCTGATTCTGGCCATTTCAATGTTGATAACATCAGAGTTTGTAAGATTTTGGGCTCTGGTATCTCTTCCTCTTCAGTATTACATGGCATGGTTTTTAAGAAGGAAACTGAAGGTGATGTAACATCTGTCAAAGATGCAAAAATAGCAGTGTACTCCTGTCCTTTTGATGGCATGATAACAGAAACTAAGGGAACGGTATTGATAAAGACTGCTGAAGAGTTGATGAATTTTAGTAAGGGAGAAGAAAATCTTATGGATGCACAAGTCAAAGCTATTGCTGATACCGGTGCAAATGTCGTCGTAACAGGTGGTAAAGTGGCAGACATGGCTCTTCATTATGCAAACAAATACAATATCATGTTGGTGAGGCTGAACTCAAAATGGGATCTCAGAAGGCTGTGTAAAACAGTTGGTGCTACAGCTCTTCCTAGATTGACTCCTCCTGTGGTTGAAGAAATGGGACATTGTGACAGTGTTTACCTCTCAGAAGTTGGAGACACACAGGTGGTGGTTTTCAAGCATGAAAAGGAAGATGGAGCCATTTCTACCATAGTTCTTCGAGGCTCTACAGACAATCTGATGGATGATATAGAAAGGGCAGTAGATGATGGTGTTAATACTTTCAAAGTTCTCACAAGGGATAAACGTCTTGTACCTGGAGGTGGAGCAACAGAAATTGAGTTAGCCAAACAGATCACGTCATATGGAGAGACATGTCCTGGACTAGAACAGTATGCCATTAAGAAGTTTGCTGAGGCATTTGAAGCTATTCCCCGGGCACTGGCAGAAAACTCTGGGGTTAAGGCCAATGAAGTAATCTCTAAACTTTATGCAGTACATCAAGAAGGAAATAAAAATGTTGGATTAGATATTGAGGCTGAAGTTCCTGCTGTAAAGGACATGTTGGAGGCTGGTATTCTAGATACTTACCTGGGAAAATACTGGGCTATCAAACTGGCCACCAATGCTGCTGTCACTGTACTTAGAGTGGATCAGATCATCATGGCAAAACCAGCTGGTGGACCTAAACCTCCAAGTGGGAAGAAAGACTGGGATGACGACCAAAATGATTGAATGGTTAATTTTTACTGTAGGCAAAGGCTGTAGGTATAGTAGTACTCTAGGAATTGCCTGATCTTTTCCTATTCTTAAATTAAGAGGTGTTTTGTGTTTATATCCTTGGCTGGTTGATAAAATAAATGTGTTGTTACTATCAAA