Transcript asmbl_16997

Sequence
Transcript Sequence for observation asmbl_16997 of TGE0000380:
CGCGGAACGAGCCACAGAGAAAAAGGTTATTGGTTGGCAGTTCAGCCAATGAGCGGGCCTGTTACTAGTTTGCGGCATCCTGTGGTATAGGGGAAGCGCTCCGGGCCTGGAATCCCTACGCGTCCCTTTGGGTTTAGCACGATGAGCTCAATCGGCACTGGGTATGACCTGTCAGCCTCTACATTCTCTCCTGACGGAAGAGTTTTTCAAGTTGAATATGCTATGAAGGCTGTGGAAAATAGTAGTACAGCTATTGGAATCAGATGCAAAGATGGTGTTGTCTTTGGGGTAGAAAAATTAGTCCTTTCTAAACTTTATGAAGAAGGTTCCAACAAAAGACTTTTTAATGTTGATCGGCATGTTGGAATGGCAGTAGCAGGTTTGTTGGCAGATGCTCGTTCTTTAGCAGACATAGCAAGAGAAGAAGCTTCCAACTTCAGATCTAACTTTGGCTACAACATTCCACTAAAACATCTTGCAGACAGAGTGGCCATGTATGTGCATGCATATACACTCTACAGTGCTGTTAGACCTTTTGGCTGCAGTTTCATGTTAGGGTCTTACAGTGTGAATGACGGTGCGCAACTCTACATGATTGACCCATCAGGTGTTTCATACGGTTATTGGGGCTGTGCCATCGGCAAAGCCAGGCAAGCTGCAAAGACGGAAATAGAGAAGCTTCAGATGAAAGAAATGACCTGCCGTGATATCGTTAAAGAAGTTGCAAAAATAATTTACATAGTACATGACGAAGTTAAGGATAAAGCTTTTGAACTAGAACTCAGCTGGGTTGGTGAATTAACTAATGGAAGACATGAAATTGTTCCAAAAGATATAAGAGAAGAAGCAGAGAAATATGCTAAGGAATCTCTGAAGGAAGAAGATGAATCAGATGATGATAATATGTAACATTTACTCCAGCATCTATTGTATTTTAAATTTCTACTCCAGTCCAATGTAACTATTTAGCCCTGGATTATACATACTGTCCAATTTTCATTAAATTTTTG