Transcript asmbl_11925

Sequence
Transcript Sequence for observation asmbl_11925 of TGE0003543:
CTTTGATCCAGTCCCAGGCGCGTTCCCCCACCACTGTGCGACCCCGCCTTTTTCAACACCCTGGGGTGAGCCGAGCTTGGGCCAATATCAGGAAAGCCCCTGAAAGTCCCAGCCCAGCCAAGAAGTAACAGGACCCTGCCCAGTCCCGGGAGCAGAGCGGCCAGGAGGAGGAAGGCTCCAAGGCGCCCCCGCCCTCGGGTCCGCTACTTGCCGGGTCCCTATTGGCTGGCGCGCTCGGCGACTGAAACAGCCGTGGGAGGGGAATTCTCGTTTATAAAAACTGCGCCCTTGGCAGGGTCCCGTCCTCTGCAACTCTTGCTCCGGGGTCCCCGCGCCAGAGACGCAGCAGCGCTCCCACCGCCCACACCCACCGCGCCCTCGCTCGCCTCTCCGCCGAAAGCCAGTCCGCGCCGCCGCAGCTGCCCAGCCCGCCACCACCCTCCGCAGTCATGTCCACCAGGTCCGTATCCTCGTCCTCCTACCGTAGGATGTTCGGCGGCCCAGGCACCGCCAGCCGGCCGAGCTCCAGCCGGAGCTATGTGACCTCGTCCACCCGCACTTACAGCCTGGACGGCGCGCTGCGCCCCAGCACGGGCCGCAGCTTGTACGCCTCGTCGCCCGGCGGCGTGTATGCCAAGCGCTCCTCGGCTGTGCGCCTGTGGAGCGGTGCCCCCCGCGTGCGGACGCTGCAGGACTCGGTAGACTTCTCGCTGGCCGACGCCATCAACACCGAGTTCAAGAACACCCGTACCAACGAGAAGGTGGAGCTGCAGGAGCTGAATGACCGCTTCGCCAACTACATCGACAAGGTGCGCTTCCTGGAGCAGCAGAACAAGATCCTGCTGGCCGAGCTCGAGCAACTCAAGGGCCAGGGCAAGTCGCGCCTGGGGGACCTTTACGAGGAGGAGATGCGGGAGCTGCGCCGGCAGGTGGACCAGCTCACCAACGACAAGGCCCGCGTGGAGGTGGAGCGCGACAATCTGGCCGAGGACATCATGAGGCTCCGGGAGAAGTTGCAGGAGGAGATGCTTCAGAGAGAGGAAGCCGAGAGCACCCTGCAGTCCTTCAGACAGGATGTTGATGGTGCTTCTTTGGCACGTCTTAACCTTGAGCGTAAAGTGGAATCCTTGCAGGAAGAGATTGCCTTTTTGAAGAAACTCCATGACGAGGAAATCCAGGAGCTGCAGGCCCAGATTCAGGAACAGCATGTCCAGATCGATGTGGATGTTTCTAAGCCTGACCTCACGGCTGCCCTGCGTGACGTACGTCAGCAGTATGAAAATGTGGCTGCCAAGAACCTTCAGGAGGCTGAGGAATGGTACAAGTCCAAGTTTGCTGACCTCTCCGAGGCTGCTAACCGGAATAATGATGCCCTGCGCCAGGCGAAACAGGAGTCAAATGAGTACCGGAGACAGGTGCAGTCCCTCACCTGTGAAGTGGACGCGCTGAAAGGATCTAATGAGTCTCTGGAACGCCAGATGCGTGAAATGGAAGAGAACTTTGCTATGGAAGCTGCTAACTACCAAGACACTATTGGCCGCCTGCAGGATGAGATTCAGAACATGAAGGAAGAAATGGCTCGTCACCTTCGTGAATACCAAGACCTGCTGAATGTTAAGATGGCTCTTGACATTGAGATTGCCACCTACAGGAAGCTGCTGGAAGGCGAGGAGAGCAGGTATGGAACAAGGACTTGGGTGCATCTATTAATAGCTGCCATTTGCTAGGTATTATGCCACTTGCTTTACATACCTTATCTTATTTCATCTTCAGAACTTTTCTTCAAGGTAGCTGCTTACTGCTTTTTGTAAATAAGGAACCTTAGATTGAGAGAGATTGAGTGACTTGCCCTAGTCAGTTAATAGCAGAGCTGGGATTTGAACCTACGATTCTGTGAAAGCCAATGCTCCTCCCACTCTATGATACCTCCAGCTCAAGCCCCTGGGGAGAAAAGGCTTGGAGTAGAAAATTTAAATGTACTAATGAGACCAATCAGGGTAAACGCTTCTGAAGCAAATCCCTCACTTATGAATTACAAGAGTAAATTTTATGTGATGAGAACGAGAAGTGTACGAATGTGTTCCTTGTTCTTCGAGTGGTTTTCTCAGAACTTTACTGTTTTTCTTTACCTTTTTTAGGATTGCTCTGCCTCTTCCAACCTTTTCTTCCCTGAACCTGAGGGGTAAGTATTTGATTGCTCTTTAGGAAAAATTTTAGGAGCTTGTAACTATTCCGTTTCTAAAGCACACATTTTTAAATGATACTTGAAAAATGCCAAGGGAAAATTCGATAAAACATCTATAATTTTGAAACCTAAGTACTGTCTTACCTTCTCTGCAAACTCCCATTTAACTTCCTTCTGATGGAGTATATATACTGCAGGAGTCTGTCTCATAGTGATTGCTTCAGTGGCATCAGACCCTGAGTTTTAAAATAGGTGACATTCTTTAGAATTATTTTGAAAGTAGTGCTTTAAACAATCGTGAACAAAAATCAAAATTATGTGAGCAAAATAGTTATTTGTCTTTTCAAAATTTCATTTTTACACATTTGGGGCCTTCGTTTTCTTTATTCAGAAACCAATCTGGATTCGCTCCCTCTGGTTGACACCCACTCAAAAAGGACACTTCTGATTAAGACGGTTGAAACTAGAGATGGACAGGTT