Transcript asmbl_11922

Sequence
Transcript Sequence for observation asmbl_11922 of TGE0003542:
CTTTGATCCAGTCCCAGGCGCGTTCCCCCACCACTGTGCGACCCCGCCTTTTTCAACACCCTGGGGTGAGCCGAGCTTGGGCCAATATCAGGAAAGCCCCTGAAAGTCCCAGCCCAGCCAAGAAGTAACAGGACCCTGCCCAGTCCCGGGAGCAGAGCGGCCAGGAGGAGGAAGGCTCCAAGGCGCCCCCGCCCTCGGGTCCGCTACTTGCCGGGTCCCTATTGGCTGGCGCGCTCGGCGACTGAAACAGCCGTGGGAGGGGAATTCTCGTTTATAAAAACTGCGCCCTTGGCAGGGTCCCGTCCTCTGCAACTCTTGCTCCGGGGTCCCCGCGCCAGAGACGCAGCAGCGCTCCCACCGCCCACACCCACCGCGCCCTCGCTCGCCTCTCCGCCGAAAGCCAGTCCGCGCCGCCGCAGCTGCCCAGCCCGCCACCACCCTCCGCAGTCATGTCCACCAGGTCCGTATCCTCGTCCTCCTACCGTAGGATGTTCGGCGGCCCAGGCACCGCCAGCCGGCCGAGCTCCAGCCGGAGCTATGTGACCTCGTCCACCCGCACTTACAGCCTGGACGGCGCGCTGCGCCCCAGCACGGGCCGCAGCTTGTACGCCTCGTCGCCCGGCGGCGTGTATGCCAAGCGCTCCTCGGCTGTGCGCCTGTGGAGCGGTGCCCCCCGCGTGCGGACGCTGCAGGACTCGGTAGACTTCTCGCTGGCCGACGCCATCAACACCGAGTTCAAGAACACCCGTACCAACGAGAAGGTGGAGCTGCAGGAGCTGAATGACCGCTTCGCCAACTACATCGACAAGGTGCGCTTCCTGGAGCAGCAGAACAAGATCCTGCTGGCCGAGCTCGAGCAACTCAAGGGCCAGGGCAAGTCGCGCCTGGGGGACCTTTACGAGGAGGAGATGCGGGAGCTGCGCCGGCAGGTGGACCAGCTCACCAACGACAAGGCCCGCGTGGAGGTGGAGCGCGACAATCTGGCCGAGGACATCATGAGGCTCCGGGAGAAGTTGCAGGAGGAGATGCTTCAGAGAGAGGAAGCCGAGAGCACCCTGCAGTCCTTCAGACAGGATGTTGATGGTGCTTCTTTGGCACGTCTTAACCTTGAGCGTAAAGTGGAATCCTTGCAGGAAGAGATTGCCTTTTTGAAGAAACTCCATGACGAGGAAATCCAGGAGCTGCAGGCCCAGATTCAGGAACAGCATGTCCAGATCGATGTGGATGTTTCTAAGCCTGACCTCACGGCTGCCCTGCGTGACGTACGTCAGCAGTATGAAAATGTGGCTGCCAAGAACCTTCAGGAGGCTGAGGAATGGTACAAGTCCAAGGTATGAACCAAGCCAGTGTGGCTGGAACAACAGGAAAGCATTTTGTTCTACAAATGCTGTACCCGTCTCTGATTCTTAAATACCCTTTAAATCCAGTGAGAAAGGTGGCTTTAAGTTCAAGTTTTGTTTGTTGTTACAGCCTCCCCACTACTCACATTCCCTAACCTCCCCCCAGAAGCAGACCCCCTTCCCATTACCCTATTTTGATTCTACTTCAGAGTAAACCCCAACACCATGACCTTGACCTCCGCCCTTTTTAAATGGGAGTAACAAAGTGAGTTTCTACTTGAAAATATCAGCGTCAGTATTCCACTGCTCTTTCTCCGGTTTTCAAAACAGAAATTCAGACACGTTTTGGCAGACATTGAGCTTTGAACTTAAAATATAAAATCTGGTTTGTATCGTGATTTGTTTGTTTGCAATTTTTAAGCTTTCTCATTTGTCCAGGTAAGGTAGCATCTTAGAATTGAGTCACTTAGATGGTCTACATTTCTGATTTCTTCCGACAGTTTGCTGACCTCTCCGAGGCTGCTAACCGGAATAATGATGCCCTGCGCCAGGCGAAACAGGAGTCAAATGAGTACCGGAGACAGGTGCAGTCCCTCACCTGTGAAGTGGACGCGCTGAAAGGATCTAATGAGTCTCTGGAACGCCAGATGCGTGAAATGGAAGAGAACTTTGCTATGGAAGCTGCTAACTACCAAGACACTATTGGCCGCCTGCAGGATGAGATTCAGAACATGAAGGAAGAAATGGCTCGTCACCTTCGTGAATACCAAGACCTGCTGAATGTTAAGATGGCTCTTGACATTGAGATTGCCACCTACAGGAAGCTGCTGGAAGGCGAGGAGAGCAGGATTGCTCTGCCTCTTCCAACCTTTTCTTCCCTGAACCTGAGGGAAACCAATCTGGATTCGCTCCCTCTGGTTGACACCCACTCAAAAAGGACACTTCTGATTAAGACGGTTGAAACTAGAGATGGACAGGTTATCAATGAAACTTCTCAGCATCACGATGACCTGGAGTGAAAATTGCACAGAGTTGGTGCAGCAATATTATTACCAGCAACAATAAAAAAGAAATTCATTTCTTAAAGAAACAGCTTTTAAGTGCCTTTCTGCAGTTTTTCAGGAGCGCAAGATAGATTTGAAATAGAAATAAGCTCTAGTTCTTAAGAACCAACACTCCTAAAAGATTTAGAAAAAAGTTTACAACGTAATCTAGTTTATGAAGAAGTCTTGTGCTAGAATACTTTTTAAAAAGTATTTTTGAATACCATTCAAACTGCTTTTTTCCAACAAGTATCTGACCAATGTGTCTCTGCTTCAATAAATCTTTGAAATCTGTTTCGGTGTCTTATTTGATAATATATGTACGATTCTCTAAATTTTATGAGGCTGTGTTTGAGTTAAAAAATTTTTTTCCTATTGGTTAGTTTGCCACAAAAATCAAGTTTAGGTCAACTTATAAATTAAACTTGTATAGTTCTTAGTTTGGTCATTTTAGATAGACTTCACTTTTTCAATTAATTTACAAATAAATGCTATAAAAATAATTTGTGCAAAAATGATAGATATTTTCATGAAATGAGTTCAGATGGGTAATTTCAGTTCTAACAAACAAACTTCCTAAAATTAAAACTTTGATAAAGTGAAAA