Transcript asmbl_11885

Sequence
Transcript Sequence for observation asmbl_11885 of TGE0026464:
CGGCTGCGCACGCGCGGTGAGGCCCGACTGGGCGACCTTCAGCGGGGCCGGTAGCACCATGTTTTCTCGGGCGGGCGTCGTTGGGGTCTCGGCCTGGGCCGTGCAGCCGCAATGGATCCAAGTTCGAAATATGGCAACTTTGAAAGATATTACCAGGCGACTAAAGTCAATCAAAAACATCCAGAAAATTACCAAGTCTATGAAAATGGTGGCAGCAGCCAAATATGCCCGAGCTGAGAGGGAGCTGAAACCGGCTCGCGTGTATGGAATAGGATCTTTGGCTCTTTATGAAAAAGCTGACATTAAGGGGCCCGAAGACAAGAAGAAACACCTCCTGATCGGAGTGTCCTCGGACAGAGGCCTTTGTGGTGCCATCCACTCCTCTGTCGCTAAGCAGATGAAAAACGAGGTGGCTACACTCACGGCGGCCGGGAAGGAAGTTAAGATTGTTGGAGTTGGCGATAAAATTAGGGGTATACTTCATAGGACTCACTCTGACCAGTTTCTGGTGACATTCAAAGAAGTGGGAAGAAAACCTCCCACTTTTGGAGACGCGTCGGTCATCGCCCTGGAATTACTAAACTCTGGCTATGAGTTTGATGAGGGGTCTATCATCTTTAATCAGTTCAGGTCTGTCATCTCCTACAAAACAGAAGAAAAGCCCATCTTTTCCCTCAATACCATTGCGAGTGCTGAGAGCATGAGCATCTACGACGACATTGATGCCGACGTGCTGCAGAATTACCAGGAGTACAGTCTGGCCAACATCATCTACTACTCTCTCAAGGAGTCCACTACGAGCGAGCAGAGCGCCAGGATGACGGCCATGGACAACGCCAGCAAGAACGCTTCTGAGATGATTGACAAGTTGACTTTGACTTTCAATCGCACGCGTCAAGCTGTCATCACAAAGGAGTTGATCGAAATCATCTCTGGTGCTGCGGCTCTGGATTAACGAAAATCAAGTTTCGTCCTCAGACACGAGGTAAAGAAGGAAAATCCAGCCACCTGATTTTGTTTTTAGTTTATTGCTGTCCTGGTCAGAAGAAATTATTGGTCCATTGTTTAAATTACTAAAGATGGCAAGATATTTGTAAATTACCTCATAATAAACAACTTAAAATAAGAAAA