Transcript asmbl_11605

Sequence
Transcript Sequence for observation asmbl_11605 of TGE0003530:
AGCATCCATTGAATTTATTCGACGTAACCACAGAGGTACCGTCTTCATACCGCCACACAGACACAAACACAGCCACAGCACAATGTCCATATCGGCGCAGGCGCACTCCTTCTGCGGCTCATTTATACGTCTTCATGTGCCACAGTCCGTCGTTTAGATAATGGATATTTTCGATGCCGATCCCCTTGTTGACTTTCTCGATGTCTTCCGCAGACATCTTCATGACTCCGACACACAGGGCGTGCTGTTTTCCTTCCGCCATGATGGCCACCACCGTATCCACCGCGGCAGGGTACAGCTTGGCCCCGGGAGACGTCAGGCCTGGACACATGATGTTCGCGCCACTGAGGACAAATTTGATGGCTCCTTTATCCACCTGCTGGCGCGGCAGGATAAACGGGTACTTGTGGAGCAGCCTCAGCGTCGGGTAAAAAGGCCCTTCTCTTTGTCTAAAAAACAGCAGCTCCCCGTTGACCGTGAGGATCTCTATGTGCTCGTGGCACCGCACTATTTTGACGGGGTCTTTCTTGGGCATGATTTGGTTAAGCCACGGTTCGATGCCTGGAAACTGCTCTGTCAACTGGTTCTTAATGCCCTTAATAACGGACGTTTTCAGCTGGATGCAGTTGGACACGTTTTCCTTCTCGTCGAATTTCTTGAACATGATCCAAGGTGAAGGGGGCGACAGTACGGAAACGCCCGCAACCAGGGAAAAGCTGATCCCGCGAGGCTCGGGCAGGAGCGCTTACCCGCGGAGCGCCGGCGAGACGGTCGCGGCGGCTGTCGTGACCCGGAAGTGGACGTG