Transcript asmbl_11493

Sequence
Transcript Sequence for observation asmbl_11493 of TGE0003514:
TAGAAAAGTCATCTTCTCACGAACCTTTAAAATTTCTGCCTCCCGAGGCAACCTTAAAGGACTAGGGCTGACTGCCTCATCTTTTTCTCCCTTGCAAAAGTCCCGTTTGCCACCATGGGGATGTACCAAGTGAGACCAAGTAGGGGGAGCGAATGGTGACTGGTACGCTGGGCTTACTGGCTGCTGCCCACTTCAGCGCTAGCACACTTCTGTAAGATCGGAACTGAGTACTAAACAACCTCTACACTTCCCCCTGGCGCCATTCCAGGGCTGGCGCCACATTCCCTGGTGGGCACGCAATGGCCGCGCCCCCTCCAGCGGCGGACGGGTCTTTTGGTACGTGCAGTCCGAGGTTGCCATGGATCGGATGAAGAAGATCAAACGGCAGCTGTCAATGACACTCCGAGGGGGCCGAGGTGTAGACAAGACCAATGGTGCCCCTGAACAGATAGGCCTGGATGAGAGTGGCGGTGGCGGCGGCAGTGACCTTGGAGAGGCCCCTACTCGTGCAGCCCCTGGAGAACCTCGCTCTGGACGGGGACCACTCAGCTCTGCACCAGAGATTGTACACGAGGACTTGAAGATGGGGTCTGACGGGGAAAGTGACCAGGCTTCAGCCACATCCTCAGATGAGGTGCAGTCGCCAGTGAGGGTGCGCATGCGCAACCATCCCCCACGCAAGATCTCCACTGAGGACATCAACAAGCGCCTATCACTACCAGCTGACATCCGGTTGCCCGAGGGCTACCTTGAGAAGCTGACCCTCAATAGCCCCATCTTCGATAAGCCCCTCAGCCGCCGCCTCCGTCGTGTCAGCTTGTCCGAGATTGGCTTTGGGAAACTGGAGACATATATCAAGCTGGACAAGCTGGGCGAGGGTACCTATGCCACCGTCTACAAAGGCAAAAGCAAGCTCACAGACAACCTTGTGGCACTCAAGGAGATCAGACTGGAACACGAAGAGGGGGCACCCTGTACGGCCATCCGGGAAGTGTCCCTGCTCAAGGACCTCAAACATGCCAACATCGTCACACTACATGACATTATCCACACTGAGAAGTCCCTCACTCTTGTCTTTGAGTACCTGGACAAAGACCTGAAGCAGTACCTGGATGACTGTGGGAACATCATCAACATGCATAATGTGAAACTGTTCCTGTTCCAGCTGCTCCGTGGTCTGGCCTACTGCCATCGGCAGAAGGTGCTACACCGTGACCTCAAGCCCCAGAACTTGCTCATCAATGAGAGAGGAGAGCTTAAGCTGGCTGATTTTGGCCTGGCTCGGGCCAAGTCAATTCCAACAAAGACCTACTCCAATGAGGTGGTGACACTATGGTACCGGCCCCCTGACATCCTGCTTGGGTCTACAGACTACTCCACCCAGATTGACATGTGGGGTGTGGGCTGCATCTTCTATGAGATGGCCACGGGCCGGCCCCTCTTCCCAGGCTCCACAGTGGAGGAACAGCTACACTTCATCTTCCGCATCTTGGGAACCCCAACTGAGGAGACATGGCCGGGCATCCTGTCCAACGAAGAATTCAAGACATACAACTACCCCAAGTACCGCTCTGAGACCCTTTTGAGCCATGCACCCCGACTTGACAGCGATGGGGCTGACCTCCTTACCAAGCTGCTGCAGTTTGAAGGTCGCAATCGGATCTCCGCAGAGGACTCCATGAAACACCCATTCTTCCTCGGTCTGGGGGAGCGGATCCACAAACTTCCTGACACTACTTCCATATTTGCACTAAAGGAGATCCAGCTACAAAAGGAGGCCAGCCTTCGCTCTTCGTCAATGCCTGACTCAGGCAGGCCAGCTTTCCGTGTGGTGGACACCGAGTTCTAAGCCACAGACCCAGGCCCCAGCAGGCAGCAGCTGGAGGGATGCCACACCCCTCACAGGGCAGACCCCAACTGCATCCTCCCTGCTTGCTACCTGCCTGACTCATGCTCGCCTGCCCACATGTCCCCTGCTGCCTGTCCAAAAACACATGATCATTGGCCTGTCAACCCACCCATTGGCCTGTCTGCTGGGTGCTAACAAAGCTCTCAATGCTCCTTGCCTGGTCTGTTTGTCTCTCTCTGTCTCAGTAGTTGCCGGCGGACAGCATGGCCGTGCCAGCCTCCCACACTGAGGCCAGGCCTATACCCCTCCCCATCATACCCTCCCCCAGGACCACTACCCCATGGCCAGCCAGGGGTCTGGAGCTAGCCCAGGCTGGGGATCTCGACTCAGACAAGATGGGGATGCCTTGAGTCTGAGGTTTCCCCTGCTTGCTTTCCTGCCTGTCCCACCTGCCTCATGTTGTGTGGGCTTTTTTGTTGTTGTTCATTTCATTCATTGTTTTTTAATTATTTTAAATGAGGTTTTCATTTTTTAAATGCAATATCTCTATACAGACTGGCTGGGCCCCACCCCCTGCGTGTGGCCCTCCCACAGTATTTTGTGCAATGAAGCCCCGCTCCCAGCCTTTCCAAGGCAGGGACACAGCCCCTATTCAGAACCCTGACCATCACCAGACCCTGGGATCGGCTAAGGGAAAGCATGCCTCAACCACTCGCCTTCCTACCCCCCACCTGCCATCCCCAGCCGCAGGGGTACCTGGGGACTACTGGAGACTCTGGGAGATGGACAAGGTTGGGGCCCCAGTCTTTCCCTCTTACAGTCCCATAGCTGGGGCCTCCTTCCTTCTCAGGGTCTCCCTAGCCCAGCCCTCTTGCCCCCACCCCACTCGGTGCTGTTGAGTAGGGGCCCTGCCAGGAACTGACCAACTCAGTGAGGAGCCATAGTATGTCTATGTGCACAGGCAGGGACAGAGGGGCTGGCGGGGGGATGGGGTGTGTGTGCCCAGGAGTTATCCCCTAACCCCTGGGGAGGGTGAGGCAGGGCAGGGACAGTCTCTGGGCTCAGTCCCAGATGGGTGATTACCTCCCCTTCCTCCACTCTAAACCCTGGGTCCCTTAAATGGGGTGGG