Transcript asmbl_11488

Sequence
Transcript Sequence for observation asmbl_11488 of TGE0003509:
GGTGAAGGAGGTGGCAGGGACGAGCACAACTACTACCGCCGGGGGAGGATAAGGCGGCGGAGGCGGCGGCGACTCTAGGCGGCCCAAGCGGCGGGGAGGAGGAGGAGGAGAAAGAGGAGGGTGGCTTGGCTTCGGCTCCTAGAGGAGTTGGCGGCGGCGCGACCCGGGGAACCGGCATTGGATTGGCGTCTCTCCCTCATTATGCTGGGCTGGGGAGAAAGGCGAATGGCCTAGTGGTCAGCAGCATGGATTGCAAGCCAGACCACCTGGGTTCAGATCTTAGCTCTGACAGCTCTGTGACCTTGGATGTCCAGCTCGCCGCTGTCCAAGAAACGTCGCGTGTCCGGGCCTGATCCAAAGCCGGGTTCTAACTGTTCCCCCGCCCAGTCTGTGTTGTCCGAAGTGCCCTCGGTGCCAACTAACGGAATGGCGAAGAACGGCAGTGAAGCAGACATAGATGAGGGCCTTTACTCTCGGCAGCTGTACGTGTTGGGCCATGAGGCAATGAAGCGGCTCCAGACATCCAGCGTACTGGTATCAGGCCTGCGGGGCCTGGGCGTGGAGATTGCCAAAAACATCATCCTTGGTGGGGTCAAGGCTGTCACCCTACATGACCAGGGCACTGCCCAGTGGGCTGACCTCTCTTCCCAGTTCTACCTGCGGGAGGAGGACATTGGTAAAAACCGGGCAGAGGTCTCCCAGCCCCGTCTTGCTGAACTCAACAGCTACGTGCCTGTCAGCGCCTACACTGGGCCTCTTGTCGAGGACTTCCTTAGTGGCTTCCAGGTGGTGGTCCTCACCAACACCCCCCTGGAGGACCAGCTTCGGGTGGGTGAGTTCTGTCACAGCCGTGGCATCAAGCTGGTGGTGGCAGACACACGGGGCCTATTTGGACAACTCTTCTGTGACTTCGGAGAAGAAATGATTCTCACTGATTCCAATGGAGAGCAGCCACTCAGTGCTATGGTTTCTATGGTCACCAAGGACAACCCCGGTGTGGTTACCTGCCTGGATGAGGCCCGACATGGGTTTGAGAATGGCGACTTTGTCTCCTTCTCAGAAGTACAGGGCATGGTTGAACTCAACGGAAGTCAGCCCATGGAGATCAAAGTTCTGGGTCCTTACACCTTTAGCATCTGTGACACCTCTCACTTCTCTGACTATATCCGTGGTGGTATCGTCAGTCAGGTCAAAGTACCTAAGAAGATCAGCTTTAAATCTTTGCTGGCCTCACTGGCAGAGCCCAACTTCGTGATGACAGACTTTGCCAAGTTTTCCCGTCCTGCACAGCTGCACATTGGCTTCCAGGCCCTGCACCAGTTCTGTGCTCAGCACGGCCGGGCCCCTCGGCCCCGCAATGAGGAGGATGCAACAGAGCTAGTGACCTTAGCCCAGGCCATGAATGCTCGAGCCCTGCCAGCAGTGCAGCAGGACAGTCTGGATGAGGACCTCATCCGGAAGCTGGCATATGTGGCTGCTGGGGATCTGGCACCCATAAACGCCTTCATTGGGGGCCTGGCTGCCCAGGAGGTCATGAAGGCCTGCTCTGGGAAGTTTATGCCTATCATGCAGTGGCTATACTTTGATGCTCTGGAGTGTCTCCCTGAGAACAAAGAGGCCCTCACAGAGGACAAGTGCCTCCCGCGCCAGAACCGTTACGATGGGCAGGTGGCTGTATTTGGCTCAGACCTACAAGAGAAGCTGGGCAAGCAGAAATACTTCCTGGTGGGTGCAGGAGCCATTGGCTGTGAGCTGCTCAAGAACTTTGCAATGATTGGATTGGGCTGTGGAGAAGGCGGAGAAATTGTCGTCACAGACATGGACACCATTGAGAAGTCAAATCTGAACCGACAGTTTCTCTTCCGGCCCTGGGATGTTACGAAGTTAAAGTCTGACACCGCTGCTGCAGCTGTGCACCAGATGAATCCACACATCCAGGTGACAAGCCACCAGAACCGTGTGGGCCCTGACACAGAGCGCATCTATGACGATGAGTTCTTCCAAAACTTGGACGGTGTGGCCAATGCCCTGGACAATGTGGATGCTCGCATGTACATGGACCGCCGCTGCGTGTACTACCGTAAGCCGCTGCTAGAGTCAGGCACACTGGGCACCAAGGGCAACGTGCAGGTGGTGATCCCCTTCCTGACAGAGTCGTACAGCTCTAGCCAGGACCCGCCTGAGAAGTCCATCCCTATCTGCACGCTGAAGAACTTCCCCAACGCTATCGAGCACACCCTGCAGTGGGCTCGGGATGAGTTTGAAGGCCTTTTCAAGCAGCCAGCAGAAAACGTCAACCAGTACCTCACAGACCCCAAGTTTGTGGAGCGGACCCTGCGGCTGGCGGGCACCCAACCTCTGGAGGTGCTGGAGGCCGTGCAGCGCAGCCTGGTGCTGCAGCGGCCACAGACCTGGGCTGACTGTGTGACCTGGGCTTGTCACCACTGGCACACTCAGTACTCTAACAACATCCGGCAGCTGCTGCACAACTTCCCTCCTGACCAGCTCACGAGCTCAGGAGCTCCGTTTTGGTCTGGGCCCAAACGCTGTCCGCATCCGCTCACCTTTGATGTCAGCAATCCCCTGCATCTGGACTACGTGATGGCTGCCGCTAACCTGTTTGCCCAAACCTACGGGCTGACGGGCTCTCAGGACCGAGCTGCGGTGGCCGCCCTCCTACAGGCTGTTCAGGTCCCCGAGTTCACCCCTAAGTCTGGCGTCAAGATCCACGTCTCTGACCAGGAGCTGCAGAGTGCCAATGCCTCTGTTGATGACAGCCGTCTAGAGGAGCTCAAGGCCACACTGCCTAGTCCAGAAAAGCTCCCTGGATTCAAGATGTACCCCATCGACTTTGAGAAGGATGATGACAGCAACTTCCATATGGATTTCATTGTGGCTGCATCCAACCTTCGGGCAGAGAACTATGACATTCCCCCTGCAGACCGGCACAAGAGCAAGCTGATTGCAGGGAAGATCATCCCAGCCATAGCCACAAGCACAGCAGCTGTGGTTGGCCTTGTGTGTCTGGAGCTCTACAAGGTGGTGCAGGGACACCGACGGCTTGACTCCTACAAGAATGGTTTCCTCAACTTAGCCCTACCCTTTTTCGGCTTCTCTGAACCCCTTGCCGCACCCCGTCACCAGTACTATAACCAAGAGTGGACGTTGTGGGATCGCTTTGAGGTACAGGGGCTGCAGCCTAACGGTGAGGAGATGACCCTCAAACAGTTCCTTGACTACTTTAAGACAGAGCATAAATTGGAGATCACCATGCTGTCCCAGGGTGTGTCCATGCTTTACTCCTTTTTCATGCCAGCTGCCAAGCTCAAGGAACGATTGGATCAGCCGATGACAGAGATCGTAAGCCGTGTGTCGAAGCGAAAGCTGGGCCGCCATGTGCGGGCGCTGGTGCTTGAGCTGTGCTGCAACGACGAGAGCGGCGAGGACGTCGAGGTCCCCTACGTACGATACACCATCCGCTGACCCCCAGCCCCTCCTGTAGACTGGCCCCAGGCCCCCTCTCCAAACCCCTTCCAGCCCAGGGCTCCCAGTTGACCTCTGGCAGTGGCCCAGCTAGCCAAGCCTGGTGTTCCCTCTTCATCCCCCTACTTGAACCCCTCTTGCCGCTGCTTCCTACCTTGTTCAGAACCTGAATCCTAATAAAGAGTTATTAACCCA