Transcript asmbl_1056

Sequence
Transcript Sequence for observation asmbl_1056 of TGE0007816:
GGGAGCGGGATCTCGACTTCCGTATTTACCAATGGCTCCAAAACATACCTCACGTGCAACTTGAGTAGCAGCAACACTGAGATCGTCGGCCACCGCTGGATGAAAGGGGACAAGGTGCTGAAGGAGGATGAGCTGCCCGGCCTGAAAACGGAGTACGAGTTGGACACAGATGAGAGTGGGGGCCAGTACCTCTGTGTCTTCCTCCCGGAGGTCGTGGGCAAGGCCAGCATCAATGTGCCAGGACCCCCCAGAGTGAAGGCCGTGAAAAAGTCAGAGCACGCCACCGAGGGGGAGGGCGTCGTGCTGGCCTGCAAGTCTGAGTCCTTCCCCCCGATCACCGAGTGGGTGTGGTACAAGGTGAGTGACACCGAGCAGCAGGTCCTCACCAACAACTCCCAGAATAAGGTCTACGTGGTGTCCGTGGAGACCAGGACGGAGCTTCACATCCTGAACCTGAACTTGGAGACCGACCCCGGCAAGTACGTCTGCAACGGCAGCAGCGTGGAGGGCACCGACCAGGCCGTCATCGTCCTGCACGTTCGCAGCCAGCTCGCCGCCCTGTGGCCCTTCCTGGGCATTGTGGCCGAGGTGCTTGTGCTGGTCACCATCATCTTCATCTATGAGAAGCGGCGGAAGCCGGACGAGGTCCTGGATGACGAGGACACCGGCTCCGCGCCACTGAAGAGCAGTGGGCACCACGTGAACGACAAGGGCAAGAACGTCCGCCAGAGGAACTCCAGCTGAGCGTGCCACCAGACGAGTCTGCACAGGGCCCGAGCGCTGCTGGAGGAGCCCGGTGTGCCTGCGCTTGCCCGATTCCCAGCTCTGTCCTCTCAAAGGAAACCTGCCCAGCGAGAGCAAACGCTGCGAATCCCAGTCACATTTCCTCTCCTTTTAAGAAAACTAAGCTAAGGTTTTCTCTCTGTAGAGTTCCGTTCCTTAGGGGTTTCGTTCCGTCTTTTTAAGAGTGTTCCAGGGGAGTCTCAAGCTTCTCTGTGGGGCCCTAATGCCCCCTCCCCCTGTGTCCCCTTGCTGTCCCCTGGGCGTCCAGCCTTCTAGTCCATCACGTTGGGGCTGCGGGGGGCAGACTGGCCTTTACCTGACACTCCCACCACGGCTCTGCCTCTGAGGCTGCTCAGTGGTCCCTGTCCTCTGCGGAAGGTCATAGGTCGTGGTGCCCAGCATCCTGCCTGTCTGGAGCCAGTGCTGTCACATCACCTCAGGTCTGTGTGACGTGGGACATCCCTGCCCTCATGGCCACCTATCAGGTGTCCTCTTCACTGCTCGGGCAAGTCCCTGTGCTGGGGGTGGTCTGGTTGACCATCTCAGAGCGGGAGTCCTGTGACAGCCCCTTCCCCGTCAGCCCGTGGCCATGCAGAAACGCCCTCCCCCCCGGGCCCACAGCCTTACTGTCCACAGCACCCTGACTCCGGTACCTGCCCCCTGCCTGCTCACCAATAAAGGCTACCCCACCTCGTC