Transcript asmbl_9652

Sequence
Transcript Sequence for observation asmbl_9652 of TGE0002306:
ACGCGTTTCCGTTTCAAAGCCTAACTTCCGGCTCTTCAGCCGGTTCCGGTCCCTGCCTTTCACTTCCGGTCGCCTTCCGCTCTGCTGCGGTCGGTTCCTGCGTCCGCTGCTGCCGGTTCCGCCACGCTGCAGGTATTTTTTCCTGAACAAAAGCTGCCTCAACCTATGTTTCAAGGATGGCTCTCCCTATCATTGTAAAATGGGGTGGACAGGAATATTCAGTGACCACACTTTCAGAAGATGATACTGTGCTAGATCTCAAACAGTTTCTCAAGACGCTCACAGGAGTGCTACCAGAACGCCAAAAGTTGCTTGGACTTAAAGTTAAAGGCAAACCTGCAGAAAATGATGTTAAGCTTGGAGCTCTCAAACTGAAACCAAATACTAAAATCATGATGATGGGAACTCGTGAGGAGAGCTTGGAGGATGTCTTAGGTCCACCTCCTGACAATGATGATGTTGTCAATGACTTTGATATTGAAGATGAAGTAGTTGAAGTAGAAAATAGGGAAGAAAACCTACTAAAAATTTCTCGCAGAGTAAAAGAGTACAAAGTGGAAATTTTGAATCCTCCCAGGGAAGGGAAAAAGCTTTTAGTACTTGATGTGGATTATACATTATTTGACCATAGGTCTTGTGCAGAGACTGGCGTAGAATTAATGCGGCCATATCTTCATGAATTCCTAACATCTGCATATGAGGATTATGACATTGTTATTTGGTCTGCAACAAATATGAAGTGGATTGAAGCTAAAATGAAAGAGCTGGGAGTGAGCACAAATGCAAATTATAAAATTACCTTCATGTTGGACAGTGCTGCTATGATAACAGTGCATACACCAAGGAGAGGATTAATAGATGTAAAGCCTCTTGGTGTTATATGGGGAAAGTTTTCGGAATTTTACAGCAAAAAAAACACCATTATGTTTGATGACATAGGAAGAAATTTTCTAATGAACCCACAGAATGGACTAAAGATAAGGCCTTTTATGAAAGCGCATCTAAATCGAGATAAAGACAAAGAACTTTTAAAATTAACTCAGTACCTCAAGGAAATAGCAAAATTGGATGACTTTTTGGACCTAAATCACAAATATTGGGAAAGGTATCTCTCAAAGAAGCAAGGACAGTAGTTACAAGTTATACTGGCAGTTATTGAAGATACTTGAGATCCATGAACTTCTTGCTTTAATGCTAGAAATCATTATAATAGTGCTGGACACTGAAGCAAATACCAGACTGCTTATACTTGGTCTTCCAGTTTTTTGTAAATTTAATTTTATATTTTTTGAAGCTCATGGCAATATGCTAAAAAACAAAAACAAACAAACAAAAAACCCTTTTTTCCCCGGTAAGAATATACTGTTACTCTTGAAAAATATTTTCTCCAGCATTGAGTACTGAGTTTTTTTTCCCACATACACAAAAAAAAGTGGACAAAAATGTATATTCAACAATGTCATTTTGTGACTTTGGAAACAAGTTATGTCTTGTGTTTTTGCCTCCTTGTGGTGTTTGACTAAATCTTAGACCAAACCCATCTTGAAAACTACTGCTCTTCCTTTTAAAACCAAAAAATATCTTTTGAGTAAGGAACCTAGTTTGGTGTTTAAGTTAAAGTCACCAAGAGTTTTTTTCATTCCTTTGTCATAGACACAGTTTCTCTTCTTGCTCCACTATTTACATATCTAAATTCTGAGCTGTCTCAGTTTGGTCTGTATGTGTATCCATGTTCTTTGAGTAAAACTGGAAAATGTCAGCCGTGATACAGATATGTCATAGTATGAAAATTAGAAAACAAGACTGAAGAATAAAATTAAGGAACGAGAGTTTCTTTTTGGTGACTAAGTAGAAGCACTTCTGCCTAAAACCATTGTCATAAAAGCAGTTAAAGGCAATACATTTTTAAATGGGACAAATCATCGATTAAGCCCTAGAAAGCATGAACAAAAAGGTTTTGTTCTGTTCCAGCTATACCTTGTCTAAGTGCAAACACTGTTTCAGTGGAAATATCTAGCCATAAGCTTTAAAAAATTATTTGCAATGCTTAAGCCTGCAGATGTGTAATGTGGCCACTGTTTTGTGTTAACAGTATTGCTTTATACAGTTCTTGTATTTGAAAGGAATCTGATCCTTTCACAGGAACATGGTATATATCGTTCTTACGGGACTATTTCAGTGGTGTAAATAATAAATACCTTTT