Transcript asmbl_956

Sequence
Transcript Sequence for observation asmbl_956 of TGE0007654:
GTCAACTTTAAAGTCGTTGTCGCCGCACCCCGGACGTCCCGCTGACCGCGTGCGTGCTTCTGAGAAATGTCTACCAACGAGACAGAAGCCCCTGCCAACACCCATGTGACAGCAGAAGAACCGGTACAGCAGCCCAGCGTGGTGGACCGCGTGGCCCACATGCCCCTTATCGGTGCCACCTGTAATATGGTGTCCGCGGCCTACACCTCCACCAAGGAGAGCCACCCCCACGTCAAGACCGTCTGCGAAGCGGCGGAAAAAGGTGTGAAGACCCTCACAGAGGCTGCCATCAGCGGGGCCCAGCCCATCCTGTCCAAGCTGGAGCCTCAGATCGCATTGGCCAGTGAATACGCCCACAAGGGGCTGGATAAGCTGGAGGAGAACCTGCCCATCCTGCAGCAGCAGACGGAGAAGGTCCTGGCAGACACCAAGGAACTCGTGTCATCTAAGGTATCGGGGGCCCGAGACGCCATGTCCAGCACGGTGTCCAGCGCCAAGGACGCAGTGGCCGCCCGAGCGACAGGGGCAGCAGATGCGACCCGGGAAGCCATGCAGAGTGGCGTGGACATGACCAAGTCGGTGGTGACCAACAGTGTCCAGTTGGTGGGCCAGATGGTGCTGAGCGGGGTGGATACGGTGCTGGGCAAGTCGGAGGAGTGGGCGGACAACCACCTGCCCATGACGGACTCCGAGCTGGGTGAGTGTGGCCCGCGGGCCAGCCCCCACCCCGACACCCCCACGCAGAGTCCGTCGGTTTGAATGACATTTAAATGAACAAATAAATGGCCGGTGGGTGAGGGGAAGAACAGAGGAGAGTCTGAGTGATTTAATTCAGGGATCTGGACACCTGCTGAGTCCCGGGCCCGATCCTAGACATAGGGACACAAGCAGTGAGCAGGCTGGAGGACGGAATCCATGACCAATTCTGGAAAGAAAAAACCGAAGGTGGGGCAGGCGGGGGCGGGGAGGGTTTCAGGACAGTGTGGGCTAGGGC