Transcript asmbl_13922

Sequence
Transcript Sequence for observation asmbl_13922 of TGE0003736:
GACACGGAACGGCTGTATTCAGTGGTGTTCCAAGAAATCTGTGGGCGCTACGGGAAGACGTACAGCTGGGACGTCAAGTCCCTCGTCATGGGCAAGAAGGCCTTCGAGGCGGCCCAGGTCATCATAGACGTGCTGCAGCTGCCGATGTCCAAAGAGGAGCTGGTGGCAGAGAGCCAGGCCAGGCTCGAAGCGCTGTTCCCCACGGCGGGCCTCCTGCCAGGGGTGGAGAAGCTGATCCACCATCTGCGAAAGCATCGCGTGCCCTTTGCCGTGGCCACCAGCTCCGGGTCCGACACCTTCGTGATGAAGACCAGCGCGCACAAAGCGTTCTTCAGCCTCTTTCATCACGTCGTGCTGGGGGACGACCCCGAAGTGAAGAACGGCAAGCCGGACCCCGACATATTCCTCGCGTGTGCGAGGAGGTTCCTCCCCCCCGCCCCCGTGGACAAGTGCCTTGTCTTTGAAGACGCTCCCAACGGGGTGGAGGCGGCCCTCGCAGCCGGGATGCAGGTGGTCATGGTGCCCGATGCACACCTGCGCCGAGACCTGACGGCCAAGGCCACCGTGGTGCTGGAGTCCCTGCAGGACTTCCGGCCCGAGCTCTTCGGGCTGCCGCCCTACGAGTGAGCGGCGGCCACGCTGCTCCGCCTGCCCCGCACCCGCGTGTCACCATCGCCACGTCGCCCTCGTCCCAGCCTCACCCCTGTGCGCTGGCTCCAAAACGATGATAGGCTGTAGCCCCACGGTCGAGAGGAAACAAGGTAGAGACAGCGGGCAGGGTGCACTGAGCACAGCTGTCCCTTGCACAGTTAGAGTTGCCTACTGTATTAGTCTTAGCATAGTCAGAGTCACACACAGTGAGCACACGTGCACACACATCCATGCTTATGTGTGAACACGCACGCAGATATGTACGCGTGTGTATACATACGTGCATAGATATGTAAAATACAAGGAAAAATGAAATTACGTTTGTGTTCATTTCTTTTTAGTTTTTCTAAACCCTGACTAGAACATGTAAAAAATGCACACATATATTTATATGCTTTAGTCCGTGTGTGTGTGTGTACGTATACATATTTATAATTTATGTTCATTGTAAATATTTACAGTGTACATAAACACTGCAGAAATTGATACTCTTTTTTGCCTTCGAAATACCTCTCGACCATATCACCGGTGGTATTTTTAGTATGAACATAATTTTAGCCTGTATCTCATACCTAGGCACATACCCACATTCAAAAATGGTTTATAGCTCAAAAATTTATCCTCTCTCCTCTGAGAACATTTATTTTTCTAATATGTGCCTTGATGTATATGTAATTTGATTTCCGAATGTGTACTTGGTACAGCCCAGAGCCACAGCACATTTCCAGGATAATTCATCAGATGTTACACTTTGGCCATTAATCCCCTTTAATTGATTTACTCTGCCTTTTGTGAGTGACAGGCATTGAAATGGGACACATACAATCACAGGGGTGTGCCTGCTTCTGTACCCTTGCAGTTGGTCTCTGTCATTAATTGTCATTGAGCTAATTTTCAACTCTCAGTTGTAGAAAAAACATAGTAATGTATGTGATTGTCTGTTGGATGATTGCCTGTGAATGATCGCCTCTGGCTGGTGACCGATTGTACCTCAGTTCAGCAGCAAATTCATTTCACATTCTCGAAGGCCTGTGTACTTGTCTGTTCTTTGAATTCTCCTTCAACTGGCTGTAACATTTCACTGGTTAGCCCGCCAGTTAATTTACTTGAATAAAATTTTTGACAGCTGTTCACATTA