Transcript asmbl_10664

Sequence
Transcript Sequence for observation asmbl_10664 of TGE0000004:
GAGTGAGCATTTCCGGCAGCCATCCCCGCGGTGCTGACATCCCGGTTGTTCTTCTGTGCCGGGGGTCTTCCTGCTGTCATGAAGGACGTACCGGGCTTCCTACAGCAGAGCCAGAACTCCGGGCCCGGGCAGCCCGCTGTGTGGCACCGTCTGGAGGAGCTCTACACGAAGAAGTTGTGGCATCAGCTGACACTTCAGGTGCTTGATTTTGTGCAGGATCCGTGCTTTGCCCAAGGAGATGGTCTCATTAAGCTTTATGAAAACTTTATCAGTGAATTTGAACACAGGGTGAACCCTTTGTCCCTCGTGGAAATCATTCTTCATGTAGTTAGACAGATGACTGATCCTAATGTGGCTCTTACTTTTCTGGAAAAGACTCGTGAGAAGGTGAAAAGTAGTGATGAGGCAGTGATCCTGTGTAAAACAGCAATTGGAGCTCTAAAATTAAACATCGGGGACCTACAGGTTACAAAGGAAACAATTGAAGATGTTGAAGAAATGCTCAACAACCTTCCTGGTGTGACATCGGTTCACAGTCGTTTCTATGATCTCTCCAGTAAATACTATCAAACAATCGGAAACCACGCGTCCTACTACAAAGATGCTCTGCGGTTTTTGGGCTGTGTTGACATCAAGGATCTACCAGTGTCTGAGCAGCAGGAGAGAGCCTTCACGCTGGGGCTAGCAGGACTTCTCGGCGAGGGAGTTTTTAACTTTGGAGAACTCCTCATGCACCCTGTGCTGGAGTCCCTGAGGAATACTGACCGGCAGTGGCTGATTGACACCCTCTATGCCTTCAACAGTGGCAACGTAGAGCGGTTCCAGACTCTGAAGACTGCCTGGGGCCAGCAGCCTGATTTAGCAGCTAATGAAGCCCAGCTTCTGAGGAAAATTCAGTTGTTGTGCCTCATGGAGATGACTTTCACACGACCTGCCAATCACAGACAACTCACTTTTGAAGAAATTGCCAAAAGTGCTAAAATCACAGTGAATGAGGTGGAGCTTCTGGTGATGAAGGCCCTTTCGGTGGGGCTGGTGAAAGGCAGTATAGACGAGGTGGACAAACGAGTCCACATGACCTGGGTGCAGCCCCGAGTGTTGGATTTGCAACAGATCAAGGGAATGAAGGACCGCCTGGAGTTCTGGTGCACGGATGTGAAGAGCATGGAGATGCTGGTGGAGCACCAGGCCCATGACATCCTCACCTAGGGCCCCCTGGTTCCCCGTCGTGTCTCCTTTGACTCACCTGAGAGAGGCGTTTGCAGCCAATGAAGCTGGCTGCTCAGACGGTCGACATTGAATTTGGGTGGGGGTTGGGATCCTGTCTGAAGTACAGACTGTTCTTGCTCTAAAAACAGGACTGTCCCTGATGGGAGCCAGGCCACAGGGAGGAGGCTTCTTTGTGGGTCTCTCCTGCAGAGGGTGGGGGTCTCAGGGTCTTAGGTGATACGGGAGAGAAAGAACGTGCCAGGCAGGAGGCCCCCTGAAGTCTGTGTACTCCGAGGTGGATCTCCATCCCCATCCACCTGTACGGACATCTTTTCCGTTGCGGTTTGAGAATGTTCCTATAATAAACCCC