Transcript asmbl_82185

Sequence
Transcript Sequence for observation asmbl_82185 of TGE0007724:
TTGAGAGTGGACCGTTTTAAGTTGGCTGTGGGTCCAGGAATAGCCTTGGAACCAAAATGGGACATGAGTTGAAGACAATCTAATCTCTGCCCTGAATCTGTTCTAGAGTGGACAATACATGGATTTAGATGCTGTTACAAAACACTCAGCATTACATGCAAAGCCCAATGGACTCATTCTTCAATATGGGACTGCTGGATTTCGAATGAAAGCAGAACATCTTGATCATGTCATGTTTCGCATGGGATTGTTAGCTGTCCTGAGGTCAAAATATACAAAATCTACAATAGGAGTCATGGTAACAGCATCACACAATCCTGAGGAAGACAATGGTGTCAAATTGGTTGATCCTTTGGGTGAAATGTTGGCACCTTCCTGGGAGGAACATGCTACCTGTTTGGCAAATGCTGAGGAAGAAGATATGCAGAGTGTGTTGATGGACATCAGCGAGAAAGCAGCGGTAGATCTGCAACAAGATGCCTTCGTAGTGATTGGTAGAGATACCAGGCCCAGCAGTCAGAAACTTTCACAGTCTGTAATAGATGGTGTCACTGTTTTGGGAGGTCAGTTCCATGATTATGGCTTGTTAACAACACCCCAGCTGCACTACATGGTATACTGTCGAAATACGAATGGGCAATATGGAAAGGCAACCATAGAAGGTTACTACCAGAAGCTCTCTAAGGCTTTTGTGGAACTTACCAAACAGGCTTTCTGCAGTGGAGATGAATATCGATCACTTAAGGTTGACTGTGCAAATGGCATAGGGGCCTTGAAGCTAAGAGAAATGGAATACTACTTCTCCCAGGAGCTGTCAGTTCAGCTGTATAATGATGGGACCAAAGGGAAACTCAATCATTTATGTGGGGCTGACTTTGTGAAAAGTCATCAGAAACCTCCACAAGGAATGGAAATGAAGTCCAATGAAAGATGTTGTTCCTTTGATGGAGATGCAGACAGAATTGTTTATTATTATCATGATGCAGATGGCCACTTTCATCTCATAGATGGTGACAAGATAGCAACTCTCATTAGCAGTTTCCTTAAAGAGCTCCTATTGGAGATTGGGGAAAGTTTGAATATTGGTGTTGTACAAACTGCATATGCAAATGGAAGTTCAACACGCTATCTTAAAGAAGTTATGAAGGTACCTGTCTATTGTACTAAAACTGGTGTAAAACATTTGCACCACAAGGCTCAAGAGTTTGATATTGGAGTTTATTTCGAAGCAAATGGTCATGGCACAGTACTGTTTAGTAAAGCTGCTGAAATGAAGATAAGAGAACTAGCAAAAGAATTAGAAGATAAGAAAAGGAAAGCTGCTAAGATGCTTGAAAACGTTATTGACTTGTTTAACCAGGCAGCTGGTGATGCTATTTCTGACATGCTGGTGATTGAGGCAATCTTGGCTCTGAAAGGCTTGACTGTACAACAGTGGGATGCTCTCTATACGGATCTTCCAAACAGACAGCTCAAAGTTAAGGTTGCAGACAGGCAACTTATTAGCACCACTGATGCTGAAAGGCAAGCAGTTACACCCCCAGGACTACAGGAGGCAATCAATGACCTGGTGAAGAAGTACGAGCTTTCCCGAGCTTTTGTCCGGCCATCTGGTACAGAAGACATAGTCCGAGTATATGCAGAAGCAGACTCACAAGAAAGTGCGGATAGCCTTGCATATGAAGTGAGCGTGGCAGTATTTCAGCTGGCTGGAGGAGTTGGAGAAAGTCCCCAACCAGGTTTCTGAAGACAGTTTTTATATTTATGAGAAACTGGATTTTTAAAAAGTTTTTACAAAATACTGCCATTATTGTGACAGTTCCAAACACATTTATAATCATAACGTTTACAGTGCACCTTACTGGATTGTTTCTAGATGATTGCTTTTCTTAAACACTACCAGAATAATACTTTAGAGATAGCTAAGCCTTATACTTGTTAAATTCAGTTTAAAAATGAAACCTACTTCTAGTTTCACCAATGTAAACTATTGGAGCTTATGTACATGATTCAGTCATTAATTTTTTAATATATGCTGGGAAAAAATCTTATTACCAACGTGTTGGGATGTCTTTTTCATTGCTGTTACCTAACCAGGAAACTGTTTTTGCAGTATTCATCACTGTGGACACAAATGGGAAGGGTAGAGAAGACTTTATACAACCAATTTTTCCATAGCAAAGTCTTCAGAACTATTCTTAAGTGACTTACCTCTTTGATTACCATCACCAGGAACTCAGAGGTGTGAATAAGGAGG