Transcript asmbl_80871

Sequence
Transcript Sequence for observation asmbl_80871 of TGE0007600:
CGAAGAACGACGAGAAAATTCCTCCGCAGAAAACGGGTTCCGGCCGCGAGCCTATAAAAAACGGGTGGCGGGGCCCCGCTGTCTTTTCAGTCGGGCGCTGAGTGGTTTTTCGGAACATGTCTGGTGGCTCCGCGGATTATAACAGAGAACATGGCGGCCCAGAGGGAATGGACCCCGATGGTGTCATCGAGAGCAACTGGAATGAAATTGTTGATAACTTTGACGATATGAACTTAAAGGAGTCTCTACTACGGGGCATCTATGCTTATGGTTTTGAGAAGCCTTCAGCTATTCAGCAGAGAGCTATTATTCCTTGTATTAAAGGGTATGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTCAACAGATCCAAAAGGTAATTCTGGCACTTGGAGACTACATGGGAGCAACTTGTCATGCCTGCATTGGTGGAACCAATGTTCGAAATGAAATGCAAAAACTGCAGGCTGAAGCACCACATATTGTTGTTGGTACACCAGGGAGAGTGTTTGATATGTTAAACAGAAGATATCTTTCTCCAAAATGGATCAAAATGTTTGTTTTGGATGAAGCAGATGAAATGTTGAGCCGAGGATTTAAGGATCAAATCTACGAGATTTTCCAAAAATTAAATACAAGTATTCAGGTGAGCTTTTATTTTTCTTCTGTAGCTGGAGATTAGGTTTATGCAGGTACTGTTAGAATACAACTGAAGTGTTCTATTGTCGTTTCCTCTGTTTAAAGTAATTGATGCATAACTGCCTGTCTACTGCAATTCCTTAGCAAGACAGAGACTCTTGGTCTCAAACACGTAGAGTATTGTGATGGTTGTGCTAATTAACTGCTTGTGTGACATCATCATCATTGTCCTTTTAAGGTTGTGTTGCTTTCTGCCACTATGCCAACTGATGTGTTGGAAGTGACCAAAAAATTCATGAGAGATCCAATTCGAATTCTGGTGAAGAAGGAAGAATTGACCCTTGAAGGAATCAAACAGTTTTATATTAATGTTGAAAGAGAGGTAACTTGTCTAATTATTAAAATAAAAATGTAGCCAGGTTTTTTTGACCTTCTTGTATAAGCACTGTGCTAAAATTGCAGAAACTAGGATCACATCTTGGTCTTTGTGATAATGCTAGCAGAGTACACACAAGAAGAAAAGTAACTGCACTAGATTGTAAAGACTGGGGTGGACCTCTTTCTTAATGTCCAGTGTCCTTTGTCTTAAGATTTGGTGCAGTATGTCTTATACCAACCTGACAGTGAACTTCTAATGATTGTAAGTTAGAAATTTAATGATTGTTACCTTTCTCTTTGAAATACTGTAGGAATGGAAATTGGATACGCTTTGTGACTTGTATGAGACCCTCACCATTACACAGGCTGTTATTTTTCTCAATACAAGGCGCAAGGTGGACTGGCTCACTGAGAAAATGCATGCCAGAGACTTCACAGTTTCCGCTTTGGTAAGGTGTTCTAATTTAGTAATGGTAATTACGATGTATTTTCATTAAAGCAGGATTTAGACTACAATATAGCTGTTAAGTGCTGTGTTGTCGTTCCCCCTGCTCAAAATAAAGCTGATTCTTTACTATACCTGTCTGCAGTGGTCTGTAGCAGCCAGGGACGCTTGGTTTCATACATAGTCAATAAAATTAAATATTGATTTGACTGGTGATTCTTGAATTAAGGTTTGTTAATTTGCAGCATGGTGATATGGACCAGAAGGAAAGAGATGTTATCATGAGGGAATTCCGATCAGGGTCAAGCCGTGTTCTGATCACTACTGACTTGTTGGCTCGTGGGATTGATGTGCAACAAGTGTCATTGGTTATAAACTATGATCTACCTACCAATCGTGAAAACTATATTCACAGAATTGGCAGAGGGGGTCGATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAAGACAAGAGGATTCTTCGTGACATTGAGACTTTCTACAACACTACAGTGGAGGAAATGCCTATGAATGTGGCTGACCTTATTTAATTCCTGGGATGAGATAGTTTTGAATGCAGTGCCCGCTGTTGCTGAATAGGCGATCACAACGTGCATTGTGCTTCTTTCTTTGGGAATTTTGAATCTTGTCTCAATGCTCATAACGGATCAGAAATACAGATTTCGTGAGCTCTTGTGAGGAAAGTCATTGGCTTTATCCTCTTTAGAGTTAGACTGTTGGGGTTGGGTATAAAAGATGGGGTCTGTAAAATCTTTTTTTCTTAGAAATTTATTTCCTAGTTATGTAGAAATGGTTGTATTAGATGTTCTCTATCATTTAATAATATACTTGTGGACTAAAAGATATAAGTGCTGTATAAAATCAGCCAATTATGTTAAACTAGCTTACCTGCCTTTATTGTGTTTGTCATTAGCCTGGAATAGAAAGGCCTTTAAAACTGA