Transcript asmbl_13391

Sequence
Transcript Sequence for observation asmbl_13391 of TGE0003697:
CGGTTTCAAACGGCTTAGAGCAGGCCCCTCGGTTCTGACCCGGCGGAGGAATTACTCTTAATTCTACGGAGAAACGAAGCACAATGGGAGATGACAGTGAGTGGATAAAACTGCCTGTTGATCAGAAATGTGAACACAAGCTGTGGAAAGCAAGATTAAATGGGTATGAAGAGGCCTTAAAGATCTTCCAGAAAATAAAGGATGAAAAGAGCCCAGAATGGTCCAAATTTTTAGGATTGATCAAAAAATTTGTAACTGATTCCAATGCAGTGGTTCAATTGAAAGGATTAGAAGCTGCACTTGTTTATGTCGAAAATGCCCATGTAGCAGGAAAAACCACAGGAGAAGTAGTGTCAGGTGTTGTAAGTAAAGTGTTCAACCAACCCAAAGCCAAAGCCAAGGAGCTAGGCATTGAGATTTGTCTGATGTACATAGAGATTGAAAAAGGAGAGGCTGTGCAAGAAGAGCTTCTAAAAGGCCTGGACAATAAGAACCCCAAGATCATAGTGGCCTGTATAGAGACACTGAGGAAAGCCTTAAGTGAATTTGGTTCCAAAATCATCTTGCTTAAGCCAATTATCAAAGTGTTGCCAAAACTCTTTGAGTCTCGAGAGAAGGCTGTTCGAGATGAAGCCAAACTAATTGCTGTGGAGATTTACAGATGGATTCGGGATGCTCTGAGACCCCCCTTACAAAATATAAACTCTGTCCAGTTGAAAGAACTAGAAGAAGAATGGGTCAAACTGCCAACAGGTGCTCCTAAACCAACTCGGTTTCTACGTTCCCAGCAAGAACTAGAAGCGAAATTGGAACAGCAACAGTCTGCTGGTGGAGATGCTGAGGGAGGTGGTGATGATGGTGACGAAGTGCCTCAGATAGATGCTTATGAGCTTTTGGAAGCAGTAGAAATTCTTTCCAAACTTCCCAAAGACTTTTATGACAAAATTGAGGCAAAAAAATGGCAAGAGAGAAAAGAAGCCCTGGAGGCTGTGGAAGTACTAGTGAAAAACCCCAAATTAGAAGCAGGCGATTATGCGGATTTAGTAAAAGCATTAAAGAAGGTAGTTGGAAAAGACACCAATGTCATGTTGGTGGCTTTGGCAGCAAAATGTCTTACTGGCCTGGCTGTTGGGCTAAGGAAGAAATTTGGACAATATGCAGGACACGTTGTGCCAACCATTTTGGAGAAATTCAAAGAGAAGAAGCCTCAAGTAGTACAAGCCCTGCAGGAGGCGATTGATGCAATCTTCCTTACTACCACACTACAGAACATCAGTGAGGATGTTTTAGCAGTAATGGATAACAAAAATCCAACCATCAAGCAACAGACATCTCTTTTTATTGCAAGAAGCTTCCGCCACTGCACTGCCTCTACCCTGCCAAAGAGCTTGCTAAAGCCCTTTTGTGCTGCTCTACTTAAGCACATCAATGATTCTGCTCCTGAAGTCAGAGATGCTGCATTTGAAGCATTGGGTACTGCTTTGAAGGTGGTTGGTGAGAAAGCAGTAAACCCATTCTTAGTTGATGTAGACAAACTCAAACTTGATAAGATCAAAGAATGTTCAGAAAAAGTAGAGCTGGTAAATGGTAAGAAAGTTGGACTGGCAGCCGAAAAGAAGGAATTCAAGCCTGTTCCTGGAAGGACTGCTGTTTCAGGGGCTGCAGGAGATAAGGACACAAAGGATATTTCAGCACCCAAACCAGGGCCCTTAAAAAAGGCACCTGCTTCTAAGGCTGGCGGGCCACCTAAGAAGGGGAAACCAACTGCACCAGGAGGCACAGGGAGTGCCGGAACCAAGAACAAGAAAGGATTGGAGACCAAAGAAATAGTGGAGCCTGAGCTCTCGATAGAAGTATGTGAAGAAAAAGCTTCAGCTGTCCTGCCTGCTACCTGTATACAGCTTCTAGACAGCAGTAACTGGAAGGAAAGGCTGGCCTGTATGGAAGAGTTCCAAAAGGCTGTTGAACTAATGGACCGAACTGAAATGCCATGCCAGGCATTAGTGAGAATGCTGGCCAAGAAACCTGGATGGAAGGAAACTAATTTTCAGGTGATGCAGATGAAGCTTCACATAGTTGCTTTGATTGCCCAGAAGGGAAATTTTTCAAAAACTTCCGCTCAGATTGTCTTGGATGGCCTTGTAGACAAGATTGGAGATGTGAAATGTGGGAACAATGCAAAAGAAGCTATGACAGCAATAGCCGAAGCTTGTATGTTGCCATGGACAGCTGAGCAGGTTATGTCAATGGCCTTCTCACAAAAGAATCCCAAGAATCAATCAGAAACTCTGAACTGGCTGTCAAATGCAATAAAAGAATTTGGTTTTTCTGGATTGAATGTGAAAGCTTTCATTAGCAATGTGAAGACAGCTCTCGCTGCGACAAACCCAGCTGTGAGGACTTCTGCCATCACCCTGCTTGGTGTGATGTACCTGTATGTTGGTCCCTCTTTGCGAATGTTCTTTGAGGACGAGAAGCCTGCCCTCCTATCCCAAATAGATGCAGAATTTGAGAAGATGCAGGGACAAAGCCCACCCGCTCCAACCAGAGGGATTTCCAAACACACCACAAGTGGTACAGATGAAGGAGAAGAAGGAGATGAGCCAGATGATGGGGGCAATGATGTTGTAGATCTTTTACCAAGGACAGAAATCAGTGATAAAATCACTTCAGAGCTGGTGTCTAAGATTGGTGACAAAAATTGGAAGATCAGGAAAGAAGGCCTAGATGAAGTGGCAGGTATTATCAATGAAGCAAAATTTATCCAACCAAATATAGGTGAACTTCCAACTGCCTTGAAGGGTCGACTCAATGATTCAAATAAAATCTTGGTGCAGCAGACGTTGAATATCCTCCAGCAGTTGGCAGTAGCCATGGGCCCAAACATCAAGCAACATGTGAAGAACTTAGGCATCCCTATCATCACAGTCCTTGGAGACAGCAAGAACAATGTTCGAGCTGCTGCCTTAGCGACTGTGAATGCTTGGGCAGAACAGACAGGCATGAAGGAATGGCTGGAGGGAGAAGATCTTTCTGAAGAGCTCAAAAAGGAAAATCCTTTCCTGAGGCAAGAGCTTCTGGGCTGGTTGGCTGAGAAACTACCAACTCTTCGTTCCACCCCCACAGACCTTATCCTGTGTGTTCCCCATCTCTACTCCTGCCTAGAGGATCGCAATGGAGATGTGCGAAAGAAGGCCCAAGATGCCTTGCCATTCTTCATGATGCATTTAGGATATGAGAAAATGGCTAAAGCTACGGGGAAACTAAAGCCAACTTCTAAAGATCAGGTATTGGCCATGCTAGAGAAAGCCAAAGCTAACATGCCAGCCAAGCCCGCTGCACCTGCTAAAGCAACTTCCAAACCAGTGGGAGGGTCAGCTCCAGCCAAATTCCAGGCTGCCTCAGCACCTGTTGAAGATTCTGTTTCCAGCACTGTAGAACCCAAGCCTGATCTGAAAAAGGCCAAAACTGTAGGAGTTTCCTCTAAAGCAAAGAGTGCACAAGGAAAGAAAGTGCCGAGCAAAACCAGCTTAAAAGAGGATGAAGATAAATCTGGTCCTATTTTTATTGTTGTTCCAAATGGAAAGGAGCAAAGAATGAAAGATGAAAAGGGATTAAAGGTGCTGAAGTGGAATTTTACTACTCCACGAGATGAATACATTGAGCAACTAAAGACTCAGATGTCTAGCTGTGTGGCTAAATGGTTACAGGATGAGATGTTTCACTCAGACTTTCAGCATCATAACAAAGCCCTTGCTGTCATGGTCGATCACTTGGAGAGCGAAAAAGAGGGTGTCATTGGTTGCCTGGATCTTATCTTGAAGTGGCTTACCCTGCGGTTTTTTGACACCAATACAAGCGTCCTAATGAAGGCTCTAGAATATTTAAAATTACTCTTCACCCTGCTAAGTGAGGAGGAGTATCATCTTACTGAGAATGAAGCATCTTCCTTCATCCCCTATCTCATCCTCAAGGTTGGAGAACCAAAGGATGTCATTCGTAAAGATGTCCGTGCCATCCTGAACCGGATGTGCCTTGTCTACCCAGCCAGCAAGATGTTCCCCTTCATCATGGAAGGAACCAAATCCAAAAACTCAAAGCAGAGAGCAGAGTGCCTGGAAGAACTGGGGTGCCTGGTCGAGTCCTATGGCATGAATGTTTGCCAACCAACTCCAGGAAAAGCCTTAAAGGAGATAGCAATTCACATAGGAGACCGTGACAACGCTGTGCGCAATGCTGCCCTCAACACCATCGTCACAGTATACAATGTACATGGGGATCAGGTGTTCAAACTTATTGGAACTCTTTCTGAAAAGGATATGAGCATGCTCGAGGAAAGGATTAAGCGATCAGCAAAGAGGCCTTCTGCTGCACCAATAAAACAGGTGGATGAGAAACCTCAGCGCACACAGAGCATAAACTCCAATGCCAACATGCTACGCAAGGGACCAGCTGAGGACATATCCTCCAAACTCAACCAAGCTCGAAACATGAGTGGGCATCCGGAGGCAGCCCAGATGGTGCGCCGAGAATTCCAGCTGGATCTAGATGAGATTGAGAATGACAATGGTACAGTCCGATGTGAAATGCCAGAACTTGTTCAACACAAACTGGATGACATTTTTGAACCGGTCCTTATTCCTGAACCCAAAATCCGGGCTGTTTCTCCACACTTTGATGACATGCATAGTAATACAGCATCTACGATCAATTTCATTATCTCCCAAGTAGCCAGTGGTGACATCAACACAAGCATCCAAGCTCTGACACAGATCGATGAGGTCCTGAGACAGGAAGACAAAGCCGAAGCGATGTCTGGCCATATTGATCAGTTTCTGATAGCCACATTCATGCAGCTAAGACTCATCTACAACACACATATGGCAGATGAGAAATTGGAGAAGGATGAGATCATCAAGTTGTATAGCTGTATCATTGGCAACATGATTTCGCTGTTTCAGATAGAGAGCCTGGCCCGGGAGGCCTCCACTGGAGTCCTGAAAGACCTGATGCACGGCCTCATCACCTTAATGCTGGATTCTCGGATTGAGGATCTGGAGGAAGGACAACAGGTGATCCGCTCTGTGAACCTCTTGGTGGTGAAGGTTCTGGAGAAGTCAGACCAGACCAACATCCTGAGTGCCCTACTTGTTTTGCTCCAAGACAGCCTGCTAGCAACAGCCAGTTCTCCTAAATTCTCAGAGCTTGTTATGAAGTGTCTCTGGAGAATGGTTCGGCTGTTGCCTGATACCATCAACAGCATTAATCTGGACAGAATTCTCCTGGATATACACATTTTCATGAAGGTCTTCCCCAAAGAGAAACTGAAGCAATGCAAAAGTGAATTTCCCATAAGGACCCTAAAGACACTGCTGCACACTTTATGCAAATTAAAAGGGCCCAAGATCCTAGACCACCTAACAATGATTGACAATAAGAACGAGTCTGAGCTGGAGGCCCACCTCTGCCGGATGATGAAGCACAGTATGGACCAGGCCGGGAGCAAG