Transcript asmbl_78536

Sequence
Transcript Sequence for observation asmbl_78536 of TGE0007455:
AAATGGAAGAAGACAAAAGAGACCTGATATCCCGAGAAATCAGCAAATTCAGAGACACACACAAGAAACTGGAAGAAGAGAAAGGCAAAAAAGAAAAAGAAAGACAGGAAATTGAGAAAGAACGGAGAGAAAGAGAGAGGGAGCGTGAAAGGGAACGAGAAAGGCGAGAACGGGAACGAGAAAGAAAAACGTGAACGAGAAGGAGAAGGAACGGGAGCGGGAACGAGAACGGGATAGGGATCGTGACCGGACAAAGGAGAGAGATCGAGATCGGGATCGAGAGAGAGATCGGGACCGCGATCGTGAGAGGAGCTCAGATCGAAATAAGGATCGGAGTCGATCTAGAGAAAAGAGCAGAGATCGTGAAAGGGAACGAGAGCGAGAAAGAGAAAGAGAGCGAGAACGAGAACGAGAGAGAGAACGTGAGCGAGAGAGAGAGCGAGAAAGGGAACGAGAGCGTGAGAGAGAGAAAGACAAGAAGAGAGACCGAGAAGAGGATGAAGAAGATGCATATGAACGAAGAAAACTTGAAAGAAAACTTCGAGAGAAAGAAGCTGCTTATCAAGAGCGCCTTAAGAATTGGGAAATTAGAGAACGGAAGAAAACCCGGGAGTATGAGAAAGAGGCTGAAAGAGAAGAAGAAAGAAGAAGAGAAATGGCAAAAGAAGCTAAACGACTAAAAGAATTCTTAGAGGATTATGATGATGATAGAGATGATCCCAAATATTACAGAGGAAGTGCTCTTCAGAAAAGATTGCGTGATAGGGAAAAGGAAATGGAAGCAGATGAACGGGATAGGAAAAGAGAGAAGGAAGAGCTAGAGGAAATCAGGCAGCGCCTTCTGGCAGAAGGGCACCCGGATCCAGATGCAGAGCTCCAGAGGATGGAACAAGAGGCTGAGAGGCGCAGACAACCACAAATAAAGCAAGAACCAGAATCTGAGGAAGAAGAAGAAGAAAAACAAGAAAAAGAGGAAAAACGAGAAGAACCCATGGAAGAGGAAGAAGAGCCAGAGCAGAAACCCTGTCTCAAACCAACTCTGAGGCCCATCAGTTCTGCTCCATCTGTTTCCTCTGCCAGTGGCAATGCAACCCCCAACACTCCTGGGGATGAGTCTCCCTGTGGTATTATTATTCCTCACGAAAATTCGCCAGATCAACAACAACCTGAGGAGCATAGGCCAAAAATAGGACTAAGTCTTAAACTGGGTGCTTCCAATAGTCCTGGTCAGCCTAATTCTGTGAAGAGAAAGAAACTCCCCGTAGATAGTGTCTTTAACAAATTTGAGGATGAAGACAGTGATGATGTACCCCGAAAAAGGAAACTGGTTCCCTTGGATTATGGTGAAGATGATAAAAATGCTGCCAAAGGCACTGTAAACACTGAAGAAAAGCGCAAACATATTAAGAGTCTCATTGAGAAAATCCCCACAGCCAAACCAGAGCTCTTTGCATATCCCCTGGATTGGTCTATTGTGGATTCTATATTGATGGAACGACGAATTAGACCATGGATTAATAAGAAAATTATAGAATACATAGGTGAAGAAGAAGCTACATTAGTTGATTTTGTTTGTTCTAAGGTTATGGCTCATAGTTCACCTCAGAGCATTTTAGATGATGTTGCCATGGTACTTGATGAAGAAGCAGAAGTTTTTATAGTCAAAATGTGGAGATTATTGATATATGAAACAGAAGCCAAGAAAATTGGTCTTGTGAAGTAAAACTCTCTTTACACTTAAGAGTTCCATTTCAGATACCATCTTTCCCATCCTTCAAAGGACTTTGAATTTTTCTTTGTCTTCAAAGACATTTGCAAGATCTGTAATTTTTTTTTAATGTAGAAAATGTGAATTTTTTTTGTCCTCCAATTCGTTGATGCCTTGTGTACTCTCTTGGTTGTAAAGACATCTGAATCCTACTTTGGTTCTCTTTATACTCACCAGGTACAAATTACTGGTATGTTTTATAAGCCGCAGCTACTGTACACAGCCTATCTGATATAATCTTGTTCTGCTGATTTGTTCCTTGTAAATATTAAAATGACTCCCCAATTCTTTTGCAGAATTGCACTTAATATTGAACTGTACTGTAAAGGAACCAACACGAACAATTTTAATTGAAAGAATACCAGTCCTTCCTTCCCTATTTGATCAGAATTGGCAAGCTTTCATGAAGGCATGAAATTAATTTTTGAAATTAGAGTGCGAAAATTAGCAGACCATCCATTCCTACTGTATCTGTATGAATGTGTTTGTGTGAATGTATATATAAAAGTGTTACTTTGCCCTGATTTGCTTTGGAGGGCTCCCGTAAACATTTCCTAACTGAAGAATAGAATCGTAAAGGAAACGTGGTGTTGTGCCAACCCAAATGTCTGGGATAATTAGGTTATTAGTCTCCCAGAGCATGGTATTCTTTTCTGGCAAGCAACAGTCTGTTGAATAGCATGGGGTTCTCCTGTTGATAGCTGGCTGCTTCAGCCTCTCTTTTTAAGGGACTGTGAATCACTGATCCCCTGCCCCTCAATTTCATTGTGCAGAGATGAGTCAGATCCTTAGATTCTGGAGAGCTTTATTTAATGCATTTTTGCACTAATTGGTCTTTAGCTTAATTTTGGTGTACCCCTTTTGTTGGGAAAAAAATGGAAAAGCATAAATGAGGGAAAAAAAACTTGAGAAACAAAAGATAAAATTAGGCCATTTGACAGACTAGGAAAATTTGACAAAATATACTAGGAATTCAGCATGGCATTTTACGTTTACATCTTATTTCTAAGGATAAAGTAAATCATTTAAGGCAGTTACCACTAATTTTTTGTTTTTGTTTTGATAAAGGGTTTATAGCTTGTGCTTGTGTATATACACACACACTTTGTTTACCTCTGCTCATCAAAGTTTGAAAATATACTGATGTTGTTAGAGACATACATTTCTTTATTGTAGATCAGAACTTCACCAGGGAGCAAAATTACCTGAAAACGTAACGAGTTTTAAACAGTTCTTAACAGAGTAGGTGTGGCTATTACCATGTCTGAGTATTTATTTAAAAGAAAAATAAAGATTTGGTGGCGGTGGGGGGATGTTAAAAAGCATAACTGAGCTTGAGTTATTAGATTTTTTTACATCTTAAAGAGGACATTTGAAAACACTGTTCTTAATATTGGACCATGACATGGTTCTATTATGTAAATATTTCAAATATTAAAAATGTATATATTTGATCTTGGGGACTCATTCTTTCAGAGTCTTATTAAATAAATGGCATCATGCTGTAATTGTGCAGTGCATACTAGAAACTTAACTTGAAAATATGGGCTAAATTAATTTTTATGAATATTAGTGACTGAAGGGCAAAGAGGATATTACCTAATTTTAGATTACTCTATATGTCTATGGAGATATCTCCTTTTAGTGTTATAATATAAATTCTGGTTTCTCAAGGGAAAATTTCAGAAACATGCTCCTTGCCATTTACAAATTAATTTACTAGCCTTTTTTCAGATTCATCCTCACCCCAACACCTTGTTTGAGCAGTTTATCATGTCTGTCTTCTCTTACCATATTAC