Transcript asmbl_7731

Sequence
Transcript Sequence for observation asmbl_7731 of TGE0007172:
CGCACCTCCCTGGCGCGCGCCCGACCGCCCGCTCGCCCCCGGCCCCGGCTCCTCCTCCTCCTCTTCTCGCCATTGCAGTTGGACTCAGCAGCCCGGTGCGCACCGCGTGGCTTTTGGGGGGAGACCCCGACGGATTGTGGCAGGAGGGTGGCGACGGCTGCGGTTCGGGAAGGGGACGCCGACAAGATAGCTGAAGTATTGATAACAACAAGGAAATCTGTCATAATTTGAAAAGATAAGCAAAATTTGATTTCCAGACACTACAGAAAAAGAAGTAAAAATGCGTCCATTGCGAATTTTTGTGAACGATGATCGCCACGTGATGGCAAAGCATTCTTCCGTTTATCCAACCCAAGAGGAACTGGAGGCAGTCCAGAACATGGTGTCCCACACAGAGCGGGCTCTCAAAGCTGTGTCTGACTGGATTGATGAGCAAGAGAAAGGCAGCAGCGAGCACGCCGAGTCCGAAAACTTGGACATGCCCCCGGAGGATGAGACCAAAGAAGGGGCCGGGGAGCAGAAGACGGAACACATGACTAGAACCCTGCGGGGCGTGATGCGTGTTGGCCTTGTGGCAAAGGGCCTGCTGCTCAAGGGGGACTTGGACTTGGAGCTGGTGCTGCTATGTAAGGAGAAGCCCACGACCGCCCTCTTGGACAAGGTGGCTGACAACCTGGCCATCCAGCTCGCTGCCGTTACAGAAGACAAGTACGAAATACTCCAATCTATCGATGATGCTGCAATTGTGATAAAAAACACAAAAGAGCCTCCATTGTCCCTGACCATCCACCTGACATCTCCTGTTGTCAGAGAAGAAATGGAGAAAGTATTAGCTGGAGAAACGCTATCAGTCAACGACCCCCCGGACGTCCTGGACAGGCAGAAATGCCTTGCTGCCTTGGCGTCCCTCCGACACGCCAAGTGGTTCCAGGCCAGAGCCAACGGGCTGAAGTCATGTGTCATTGTCATTCGCGTCCTGAGGGACTTGTGCACCCGCGTGCCAACCTGGGGCCCTCTCAGAGGATGGCCCCTCGAGCTTCTCTGTGAGAAGTCCATCGGCACAGCCAACAGACCCATGGGTGCCGGCGAGGCCCTGCGGAGAGTGCTGGAGTGCCTGGCGTCGGGCATCGTGATGCCAGATGGTTCTGGCATTTATGACCCTTGTGAAAAAGAAGCCACTGATGCTATTGGGCATCTAGACAGACAGCAACGGGAAGATATCACACAGAGTGCGCAGCATGCTCTGCGACTCGCCGCGTTTGGCCAGCTGCATAAAGTCCTGGGTATGGACCCTCTGCCTTCTAAGATGCCCAAGAAACCAAAGAATGAAAACCCAGTGGACTACACGGTTCAAATCCCCCCCAGTACCACCTATGCCATTACGCCCATGAAACGCCCGATGGAGGAAGATGGAGAGGAAAAGTCTCCCAGCAAAAAGAAGAAGAAAATTCAGAAGAAAGAGGAGAAGGCAGAGCCTCCCCAGGCTATGAATGCCCTGATGAGGCTGAACCAGCTGAAGCCGGGGCTGCAGTATAAACTGGTTTCCCAGGCCGGGCCGGTCCACGCCCCCATCTTCACCATGTCTGTGGAGGTAGATGGCAGCTCATTCGAGGCCTCCGGACCATCCAAAAAGACTGCCAAGCTGCATGTGGCTGTTAAGGTATTACAGGACATGGGTTTGCCTACGGGCACCGAAGGCAGAGACTCCAGTAAGGGGGAGGACTCAGCTGAGGAGACAGAATCCAAGCCAGCCGTGGTGGCCCCTCCGCCTGTGGTGGAAGCCGTCTCAACCCCCAGTGCTACCTTCGCCTCAGACCCTACTGCCGAGAACGTAAAACAGCAGGGGCCGATCCTGACCAAGCATGGCAAGAACCCTGTCATGGAGCTTAATGAGAAGAGGCGTGGCCTCAAGTATGAGCTCATCTCAGAGACTGGCGGCAGCCATGACAAGCGCTTTGTCATGGAGGTGGAGGTGGATGGACAAAAGTTTCAAGGTGCTGGCTCAAACAAAAAGGTGGCAAAAGCATATGCTGCTCTTGCTGCACTAGAAAAGCTGTTCCCCGACGCCCCTCTTGCCCTTGAAGCAAATAAAAAGAAGAGAGCTCCCGTCCCTGTCAGAGGTGGACCGAAATTTGCTGCTAAGCCCCATAACCCTGGCTTTGGCATGGGAGGCCCCATGCACAACGAAGTGCCCCCGCCCCCAAACCTTCGAGGGCGGGGAAGAGGAGGGAACATCCGTGGTCGAGGGAGAGGGAGAGGGTTCGGTGGTGCCAACCATGGAGGCTACATGAATGCTGGCGCTGGATATGGCAGCTACGGGTACGGTGGCAACTCGGCGACAGCCGGCTATAGTGACTTTTTCACAGACTGCTACGGCTATCATGATTTTGGGTCTTCCTAGAGCATCTAAAAGTATTGCACACAAAATCAACTTTTTACTCCAATTTTCTCGAACTCCAAAACCCAAAGTGTCCGTGCTGTGCCCCTGTGCTTCACTGGGTTTCTCAACCGTGGCTTGTCACCGCAGCTTGTCTGAAACTCTTAGCCTGCAGAATTTAAGACAATGGCAGTTTTTATCGTGATTTGCCTTTGAACTTGGTCATATCGAAGTTCACAATAAGTGGAAAACAATTTTCAGAGAATGCATTTTTTTGTGCAGAATTGCACAGAATTCTAGAGCCAGCGTTGGTCAGCATCAAGGCAAAAGCCCACCTTTGCTTTTTATGGAAAGCATTACTTTATTTAAGAGACAGATAATGATGCATTTTAATCTACCTTTGTCTTAATTTACAGCAGGTTTTGTATGAATTTTTAACCTTTTAACAATTTCCCAAATCTGGTTGATGCCTTTGACAGTGATGAAAATGATTTCACCACATCCGAATCCAGAGCAACTGGCTTTTTTTTTTATGAGCATGTAAAACGTTGGGAACATTCGGGAATTGTATATTGTGCTAATAAGTTACCTCTCCC