Transcript asmbl_13286

Sequence
Transcript Sequence for observation asmbl_13286 of TGE0003691:
CACTAAGCCACAGAGCGTCAAGTAAGCAGGAAGAGGCCGCAGAGGTCAGCCCTGTCCTGCGAGAGGAAACATTCCCTTAACGGGGTCAGCGACCCTCACGTAGAGTTAAGAACTGCTGTTGTGGGGTGGTCACTAAATCTAACCACACTTAAAAACAAAGAAGGGGCTCACCGCCAGGAAGTGTGAATACATGATATGCCGTTTAAATGTGTGGCCACGGTGTGAGCTAACACTGGCTGCCTGTCTCCATAGGTCGTGTGATAGCCACTTTCGCTTGTTCTGGAGAAAAGGAGGTAAATTTGGCTGTGCAGAATGCCAAGGCTGCCTTTGAAGTATGGAGTAAAAAATCTGGCATGGAGCGTGGTCGAATCCTTTTGGAGGCTGCCAGGATCATTAGGGAACGGAGGGATGAAATTGCCACCGTGGAGACCATCAACAATGGCAAATCCATCTTTGAGGCCCGCTTGGATGTTGACAGTTCCTGGCAGTGCCTGGAGTATTACGCAGGCTTGGCCGCGTCCCTGGCCGGTGAACACATCCAGCTCCCAGGCGGGTCCTTCGGCTACACCAGGAGGGAGCCGCTCGGCGTGTGTGTGGGGATAGGCGCCTGGAACTACCCCTTCCAGATCGCCTGCTGGAAGTCGGCGCCAGCTCTGGCCTGCGGTAACGCCATGGTCTTTAAGCCGTCTCCCTTCACGCCTGCATCCGTGCTGCTGCTGGCCGAGGTCTACGCCCAGGCCGGGGTGCCTCCCGGCCTCTTCAACGTGGTGCAGGGGGGCGCCGCCACGGGCCAGCTCCTATGCCAGCACCGCGACGTGGCCAAGGTCTCCTTCACCGGCAGCGTGCCCACGGGCACGAAGATCATGGAGATGTCGGCGAAGGGGATCAAACCCGTCACCTTGGAGCTGGGCGGCAAGTCCCCGCTGATCATCTTCTCAGACTGCGACCTGGACAGCGCCGCCAAGGGGGCGCTGATGGCCAACTTCTTGACACAGGGAGAGGTTTGCTGCAACGGCACGAGGGTATTCGTGCAGAAGGAAATTCTCGACAGATTTACCGCAGAAGTGGTGAAACAGACCAAAAGGATAAAACTCGGGGACCCCCTTCTAGAGGACACCAGGATGGGCCCCCTCATCAACCGGCCACACCTGGAGCGTGTCCTTGGGTTCGTCAAACTGGCAAAGGAGCAGGGCGCTACAGTGTTATGTGGTGGAGAGCCCTACGTGCCCGAGGACCCCAAGTTAAAGGACGGGTTCTACATGACGCCTTGCGTGTTAACTCATTGCAGGGACGACATGACCTGTGTGAAAGAAGAGATCTTTGGACCAGTTATGTCCATTTTATCATTCGACACCGAGGCTGAGGTTCTGGAAAGAGCCAACGATACCACGTTTGGACTGGCCGCTGGCGTCTTCACCAGGGACATCCAGCGTGCTCACAGAGTGGTCGCCGAGCTCCAGGCCGGAATGTGCTTCATCAACAACTACAGCACCTCCCCCGTGGAGCTGCCCTTTGGAGGGTATAAGAAGTCAGGGTTTGGCAGAGAGAACGGCCGTGTGACCATCGAGTATTACTCACAGCTAAAGACTGTGTACGTGGAGATGGGCGATGTGGAGTCTGTGTTTTGAAATCGCGCCGTGAAACCCGTCGACGTGGCCAGGCCGAGGAACAGAGAGGACCGGCCCTCTCGGCGGGCCCGGCCTTCCCCATCCCCCACCCCCCTGCACCCCGCTTCCGTCACTGGGGACAGGATTCGTCACCCAGACATCTTCCTAACTGAAACTGTAGAAGTGCCTTCTCCTCTGCTGTTACGGTTTCCTTTGGAGGGTTGAGCAGCAGCAGGTGCTCTTCTCTGCCTCCCCGTCCAATCTTGTCTCCCAGAGGTAACTACTGTTAACACTTGGGTACTGGTTTTTCTAGGATTTTCTTCAAGGGGATAACTGCTAACGAACCCTTTATCTGGACGGGGCCTCGTGTAAGTGGGCCCACCTCACACCATTCTTATGTATTTTAAGATGTCCTTGGTTGGCAGATGCCTACGCTACAGGTATTGATAGACGTCTTGGAATGGTATTAAAGCGAGCGAGAAAAAGCAAACCGCCCCCTGCTGGCTCCTTCCGTTGCAACAGCACAGAGACCTGATCCGACCTGGCTTGTTGTCACCTCCCATTCAGAGGCAGGTCTCGCCTGGGCAGGTCTTGCGCATACGGAAGGTACCACCGGGCCCCTTCCTTCCGCCTACTGCCTTTCGTTTCGTTTCGTGCTCTGTAGGTAGGTCCTCTTGCTGCTTAAGGCCAGGCTCCGGTTGGCTGAAGTTGGCTGACCGTCCGCCTCTTGCAGAGGGGCGAGAGCACCCCCGAGCCCCGCCCGCTTCTTACAATGCAGAGTCCACTCAGCCTCTCTGGCAGGGCTGCTGCTGAGGGTGGCTTTCCTCTGGAATAAAACGGCTCCTTGGTTTTTCTCATA