Transcript asmbl_7684

Sequence
Transcript Sequence for observation asmbl_7684 of TGE0007136:
CCGCGGTGTCCGGTCCCAGCCTTCTCTGGGAGCGGGCGGTGGGCAACGCCGGGGTGACCCGCGCCCCTCGTTCTTGAGCCCGCGCGCTCTGAGAGGGTGCTCGGACAGATTGAAGCCATGGCTATTCTTTTTGCCGTCGTTGCCAGGGGAACCACCATCCTTGCCAAACACGCTTGGTGTGGAGGAAACTTCCTGGAGGTGACAGAGCAGATTCTGGCTAAGATACCTTCTGAAAATAACAAACTAACGTACTCACACAGCAACTATTTGTTTCATTACATCTGCCAAGACAGGATCGTGTACCTTTGTATCACTGATGATGATTTTGAACGTTCCAGAGCCTTTAATTTTCTGAATGAGATCAAGAAGAGATTCCAGACCACGTATGGTTCAAGGGCACAGACAGCACTCCCATATGCCATGAACAGTGAGTTCTCAAGTGTCTTGGCCGCACAGCTGAAGCATCATTCTGAGAATAAGGGCCTAGACAAAGTGATGGAGACTCAAGCCCAAGTGGATGAACTGAAAGGAATCATGGTCAGAAACATAGATCTGGTAGCTCAACGAGGAGAAAGATTGGAATTATTGATAGATAAAACAGAAAATCTCGTGGATTCGTCTGTCACCTTCAAAACAACCAGCAGAAACCTTGCCCGAGCCATGTGCATGAAGAATCTCAAGCTCACCATCATCATCATCGTCGTATCAATCGTGTTCATCTACATCATCGTGTCACCTCTGTGTGGTGGATTTACATGGCCCCGCTGTGTGTAAAAATAGAAAAGACAAAGTTATTCACCGGACGACACGAGAGAACAAGGAGTTAAAAGGCCGAATGATCTAAACCTTTCACTACTGACAGATGGCGTCTGCCAGTCTCTTCAGCCCTCTCTTTCTCTTTCTGTTTTTAATCCTGTTCTATGCATCCAGATTTATCTTTGTCCTCTCAGTCAGTTTATTCCAGTGTACTTCAAAATGA