Transcript asmbl_13285

Sequence
Transcript Sequence for observation asmbl_13285 of TGE0003689:
CTCTTCCCGACCCGCCTGGCGGCGCTTCCCTGGCTTCTCCGCGCTCTCGGGCCTGCTCCTGTCGCCGCCATGAGAACTGGCACCTTCGTCGTGTCGCAGCCGCTCAACTTCCGCGGCGGGGCCCGCGTGGAGCCGGCGGACGCCTCGGGCACCGAGAAGGCGTTCGAGCCGGCCACCGGTCGTGTGATAGCCACTTTCGCTTGTTCTGGAGAAAAGGAGGTAAATTTGGCTGTGCAGAATGCCAAGGCTGCCTTTGAAGTATGGAGTAAAAAATCTGGCATGGAGCGTGGTCGAATCCTTTTGGAGGCTGCCAGGATCATTAGGGAACGGAGGGATGAAATTGCCACCGTGGAGACCATCAACAATGGCAAATCCATCTTTGAGGCCCGCTTGGATGTTGACAGTTCCTGGCAGTGCCTGGAGTATTACGCAGGCTTGGCCGCGTCCCTGGCCGGTGAACACATCCAGCTCCCAGGCGGGTCCTTCGGCTACACCAGGAGGGAGCCGCTCGGCGTGTGTGTGGGGATAGGCGCCTGGAACTACCCCTTCCAGATCGCCTGCTGGAAGTCGGCGCCAGCTCTGGCCTGCGGTAACGCCATGGTCTTTAAGCCGTCTCCCTTCACGCCTGCATCCGTGCTGCTGCTGGCCGAGGTCTACGCCCAGGCCGGGGTGCCTCCCGGCCTCTTCAACGTGGTGCAGGGGGGCGCCGCCACGGGCCAGCTCCTATGCCAGCACCGCGACGTGGCCAAGGTCTCCTTCACCGGCAGCGTGCCCACGGGCACGAAGATCATGGAGATGTCGGCGAAGGGGATCAAACCCGTCACCTTGGAGCTGGGCGGCAAGTCCCCGCTGATCATCTTCTCAGACTGCGACCTGGACAGCGCCGCCAAGGGGGCGCTGATGGCCAACTTCTTGACACAGGGAGAGGTTTGCTGCAACGGCACGAGGGTATTCGTGCAGAAGGAAATTCTCGACAGATTTACCGCAGAAGTGGTGAAACAGACCAAAAGGATAAAACTCGGGGACCCCCTTCTAGAGGACACCAGGATGGGCCCCCTCATCAACCGGCCACACCTGGAGCGTGTCCTTGGGTTCGTCAAACTGGCAAAGGAGCAGGGCGCTACAGTGTTATGTGGTGGAGAGCCCTACGTGCCCGAGGACCCCAAGTTAAAGGACGGGTTCTACATGACGCCTTGCGTGTTAACTCATTGCAGGGACGACATGACCTGTGTGAAAGAAGAGATCTTTGGACCAGTTATGTCCATTTTATCATTCGACACCGAGGCTGAGGTTCTGGAAAGAGCCAACGATACCACGTTTGGACTGGCCGCTGGCGTCTTCACCAGGGACATCCAGCGTGCTCACAGAGTGGTCGCCGAGCTCCAGGCCGGAATGTGCTTCATCAACAACTACAGCACCTCCCCCGTGGAGCTGCCCTTTGGAGGGTATAAGAAGTCAGGGTTTGGCAGAGAGAACGGCCGTGTGACCATCGAGTATTACTCACAGCTAAAGACTGTGTACGTGGAGATGGGCGATGTGGAGTCTGTGTTTTGAAATCGCGCCGTGAAACCCGTCGACGTGGCCAGGCCGAGGAACAGAGAGGACCGGCCCTCTCGGCGGGCCCGGCCTTCCCCATCCCCCACCCCCCTGCACCCCGCTTCCGTCACTGGGGACAGGATTCGTCACCCAGACATCTTCCTAACTGAAACTGTAGAAGTGCCTTCTCCTCTGCTGTTACGGTTTCCTTTGGAGGGTTGAGCAGCAGCAGGTGCTCTTCTCTGCCTCCCCGTCCAATCTTGTCTCCCAGAGGTAACTACTGTTAACACTTGGGTACTGGTTTTTCTAGGATTTTCTTCAAGGGGATAACTGCTAACGAACCCTTTATCTGGACGGGGCCTCGTGTAAGTGGGCCCACCTCACACCATTCTTATGTATTTTAAGATGTCCTTGGTTGGCAGATGCCTACGCTACAGGTATTGATAGACGTCTTGGAATGGTATTAAAGCGAGCGAGAAAAAGCAAACCGCCCCCTGCTGGCTCCTTCCGTTGCAACAGCACAGAGACCTGATCCGACCTGGCTTGTTGTCACCTCCCATTCAGAGGCAGGTCTCGCCTGGGCAGGTCTTGCGCATACGGAAGGTACCACCGGGCCCCTTCCTTCCGCCTACTGCCTTTCGTTTCGTTTCGTGCTCTGTAGGTAGGTCCTCTTGCTGCTTAAGGCCAGGCTCCGGTTGGCTGAAGTTGGCTGACCGTCCGCCTCTTGCAGAGGGGCGAGAGCACCCCCGAGCCCCGCCCGCTTCTTACAATGCAGAGTCCACTCAGCCTCTCTGGCAGGGCTGCTGCTGAGGGTGGCTTTCCTCTGGAATAAAACGGCTCCTTGGTTTTTCTCATA