Transcript asmbl_7651

Sequence
Transcript Sequence for observation asmbl_7651 of TGE0007115:
GAGAGAATGATAAACGACTGAGAGAAGGATCAAGGAAACAACTGAGGAGAATTTAGGGGCAGGTTATGCGACGTGGAAATGGGGGCATAGGTTTCTGGGGAGGGCACACACGGAGTGGCGTCTTGCATCTCTCGGTAGATTCCAGAATCCTCCGCTATTCAGGACCGTGCAGGAAGACCATGCCGAGACCCAAGAAGAGGATGGCTGGGGCTGCTGAGCCAGACAAGAAGGGACCAGCAGGAAAACGTCCCAAGATTAAGAACCTAGGTGAGACATCAACTAAAGTGGAGAACTCCAGCCCTCAGAAGACTTCAACCTCTAAAAATTGCACGAAAAATCTAAGCAGCTATTGGCTGATGAAGTCAGAGCCAGAAAGCCGTCTAGAGAAAGGTGTAGATGTGAAGTTCAGCATTGAGGATCTCAAAGCACAGCCCAAGCAGACAGCATGCTGGGATGGTGTCCGCAACTATCAGGCTCGGAACTTCCTTAGAGCCATGAAGCTGGAGGAAGAAGCTTTCTTCTACCATAGCAACTGCAAAGAGCCAGGCATTGCCGGACTTATTAAGATTGTGAAGGAGGCTTACCCAGACCACACACAGTTTGAGAAAAGCAATCCCTATTATGATCCCTCCAGCAAAGAAGACAACCCCAAATGGGCCATGGTGGATGTACAGTTTGTTCGGATGATGAAGCGTTTCATTTCCTTGGCGGAGCTCAAAACCCATCACCAAGCTCACAAAGCCACTGGTGGCCCCTTAAAAAATATGGCACTCTTCACTCGCCAGAGACTCTCAATTCAGCCCCTGACCCAAGAAGAATTTGATTTTATTTTGAGCCTGGAGGAAAAGGAACCAAGTTAACTGATACGCTGGAATGGGCAAGACATTATTCCAAAGGAGTGAAGCTTTTATAAGACAAAAGGTGTGAGGAGGCTTGCTTGTTATGTTCATTGGGGTTTGTGTACATAGGTGGGTTTTGTGTACTTTCTCAATAAAATGCTAATATCAA