Transcript asmbl_13214

Sequence
Transcript Sequence for observation asmbl_13214 of TGE0003685:
GGCGGCGTGGGAGGCTGGAGCCGAGTGTGAACCTGAGGAAGGAGCGGGGCCAGCGCGCAGGCCCGGAACCGCCGGAGCCGGGGCTGCCGGCGACGCCCCAGAGCGGAAGAGGGAAGTGAAGGCACCAGGCTGCGGGTTCCTGTCTGACTGGGCTTGCTAAGGTAGAGGCAGCACGGAGAAGAGGCCTTTGCCACCGCTCCGGATCGGAGATGTCGAAGAACACGGTGTCGTCGGCCCGGTTCCGGAAGGTGGACGTAGATGAGTACGACGAGAACAAGTTCGTGGACGAAGAAGACGGGGGCGACGGACAGGCGGGGCCCGACGAGGGCGAGGTGGACTCCTGCCTGCGGCAAGGAAACATGACAGCTGCCCTGCAGGCAGCTCTGAAAAACCCCCCTATCAACACCAAGAGTCAGGCTGTGAAGGACCGGGCAGGCAGCATTGTCCTGAAAGTGCTCATCTCTTTTAAAGCTAATGATATTGAAAAGGCAGTTCAATCCCTGGACAAGAATGGTGTGGATCTCCTAATGAAGTATATTTACAAAGGCTTTGAGAGCCCCTCTGACAATAGCAGTGCTGTGTTATTGCAATGGCATGAAAAGGCACTTGCTGCTGGAGGAGTGGGGTCCATCGTTCGAGTGTTGACTGCCAGAAAAACCGTGTAATCCAGCAGGAGCTGGATGTCTCCTGTGGGTGTGGGAATTGCTGGTACAAAGACCAAAACAACCAAATGCCACAGCTGCCCTTTGGGTAGCATCTATTTCTCTCAGCTTTGCCTTCTTGCTTCCTCTTTCATATCTATAAAGAAGAAAATTACATATCAGTTTTCCTTTAATGAAAATTGGGATGACATAGAGGGAATGTTTCAACAGAAGTGTTTCATGCTCTCAAAACTATTTCAGTGATGTGTATACCAATCTGTATATAGTATAATTTACATTCACGTTTAATTGTGTAATTTCTAACCCCTTAATTGGCTGGCATTTTTTGTTTTTCTGTTTTTTGTTTTTGGTTTTTTAGTTTTGTTTTTAACTAATAGTGATCTAAATTGGATGCTGGTTTCCTAACTCGTTGCTAGCCAGGAAATGACTCTTATAAAAAATATTTTTCAGAGACTGGCAGCTATTAACATTGCAAAACTGGACCATACTTCCTTTATTTAAGCAAAATGTGTTTCTGGGACAAGTGGTGGGTGAGCACCACTACCGCGTTCCAGTTTTGTTTCTGCTTGCCTCCAGATCATGTGAGTTTAAGTATGCTTCTTCCTCTCAGCATCCAATAATCATGGCCTCTCGATTTCTTTGGTCACCAGGGTCCAGAGCAAGGAGTCTTGCTCTATGCAGATGTATCTATAAAATACCAGAGCCTTTTTGGCATGAGCATAAAACTTTGTTTCAATTATGTGGCCCTATTTGGAGAAACTACTCCAAATCAGAAAGGACATGGAAACTATGATGTAGTTCAAACTCTGGGCGGCCTCCGAATGAAATGATACTTCCCATAGAGCTATAGTAGCTGCCTTAGACATTATGAGGTATATAACCAGTATTTAATATGCCCTATAAATGTCTTCAGTGTTCTTCAGGGTAATTGGGATCTCAAAAGATTTGGTTCAGATCCAAACACGCACACATTCTGTATTTTAGCTCAGTGGTTT