Transcript asmbl_76492

Sequence
Transcript Sequence for observation asmbl_76492 of TGE0026027:
ACCGGGACCTTTTCTCTTTCCCCGGAAGGAGAGCGAAGCCGCGGCTGGGCGCGCAAGGTGGGGAGGTGCGGAGCTGGGCTTTGGGAGGCGGGGCGCGCGCGGGGGGGTACCCCTCCCTTCGGTCCTCCTTGCGGTGGACGGGTCTGCCTGCCCAGATCCGCCGCCCAGCGAGGATCCAAGGCATCTGTGCGGCCCGGGGGGCTCGGCCGGGACAAGCTAGGGGCACGGTGCCCGGGGCGGGTGGGCGGTGACCCGACGCAGGGCAAGCGGAAGAATAGATTCGCGGACCTCCGAGGGGAACCTGAGAGTGCAGACCTTGAGCGGACGTGAAACCGGCGCGGTCCGGGGGCCGGGAACTGCTCAGCGCTGCAGGGCTCCACGGCGCTGCCCGCCCGCGCGTTTCCAGGGGCGCGGGGAGCAGGTGAACAGGTCCTCGCTCACAGCTCCACGCCCTCACGCGCTCTCGCCCCGGCCTCCGCTCCCGCTTGCAGCCATGGGCCCGGGTCTCCGCCTCGCCACCCGCGTCCCACGCCAGATGCTTTGCGCGCTGGCCTTGATGGTGGCCGCTGGCGGCCGCATTGCCTCTGCTTTCAACCTGGACACCCAATTCCTGGTGGTGAAGGAGGCCAGGAACCCGGGCAGCCTCTTCGGCTACTCGGTCGCCCTCCATCGGCAGACGGAGCGGCGGCGGCGCTACCTGCTCCTGGCTGGTGCCCCCCGGGATCTTGCTGTGCCTGATGGCTATACCAACCGGACTGGTGCTGTGTACCTGTGCCCACTCACTGCCAACAAGGACGACTGTGAGCGGATGGACATCGGAGAGAAAAGTGACCCTGACCATCACATAATTGAGGACATGTGGCTGGGGGTGACTGTGGCCAGCCAGGGCCCTGCAGGCAGAGTCCTGGTCTGTGCCCACCGCTACACCCAGGTGCTGTGGTCGGGGCTGGAGGACCAGCGGCGCATGGTGGGCAAGTGCTATGTGCGGGGCAATGACCTAGAGCTGGACCGCACTGATGACTGGCAGACCTACCACAACGAGATGTGCAACAGCAACACTGACTACCTGGAGACGGGCATGTGTCAGCTGGGCACCAGTGGCGGCTTTACCAAGAACACTGTGTACTTCGGTGCTCCCGGTGCCTACAATTGGAAAGGAAACAGTTACATGATTCAGCGGAAGGACTGGGATTTATCTGAATACAGTTACAAGGGCCCAGAGGACCAAGGAAACCTCTATATTGGGTACACAGTGCAGGTGGGCAGTGCCATCCTGCACCCCACGGATATCACCATTGTGACAGGTGCCCCACGGCACCAACATATGGGCGCTGTCTTCTTGCTGAGCCAGGAGGTAGGCGGAGACCTGCGGAGGAGGCAGGTGCTGGAGGGCACACAGGTGGGCGCCTATTTTGGCGGTGCCATTGCCCTGGCAGACCTGAACAATGATGGGTGGCAGGATCTCCTGGTGGGTGCCCCCTACTACTTTGAGCGGAAAAAGGAGGTAGGGGGTGCCATCTATGTCTTCATGAACCAGGCAGGCACCTCCTTCCCTGCCCACCCCTCCCTCCTTCTTCACGGTCCTAGTCACTCTGCCTTTGGCTTCTCCGTGGCCAGCATTGGTGACATCAACCAGGATGGATTCCAGGACATTGCTGTGGGAGCTCCATTTGAAGGCTTGGGAACAGTGTACATCTATCACAGCAGCTCCAGGGGGCTTCTCCAACAGCCCCAACAGATAATCCACGGAGAGAAGTTGAGACTACCTGGCTTGGCCACCTTTGGCTACTCCCTGAGTGGGCGGATGGATGTGGATGAGAACTCCTACCCGGACCTGCTAGTGGGGAGCCTTTCAGACCGCATCGTGCTCCTGAGGGCGCGGCCTGTCATCAACATCCTCTATAAGACCTTGGTGGCCAGGCCTTCGGTGCTGGACCCCACACTCTGCACAGACACCTCTTGTGTGCAGGTGGAGCTGTGCTTTGCTTATAACCAGAGTGCTGGGAACCCCAACTACAGGCAAAATATCACCCTGGCCTATACACTGGAGGCTGACCGGGACCGCCGCCCACCCCGACTTCGCTTTGCACAGAGCCAGTCAGCTGTCTTTCATGGCTTCTTCTCCATGCCCGAGATGCGCTGCCAGACGTTGGAGCTGCTCCTGATGGACAACGTCCGTGACAAACTCCGTCCCATCGTCATCTCCATGAACTACTCTTTATCTTTGCGTATGCCGGAGCGCCCCAGGCTGGCGCTGCAGTCCCTGGACGCCTACCCGGTCCTCAACCAGGCGCAGGCTCTGGAAAACCACACTGAGGTCCAGTTCCAGAAGGAGTGTGGGCCGGACAACAAGTGCGACAGCAACTTGGAGATGCAGGCAGCCTTCGTGTCCGAGCAGGGGCAGCCGATGAGCAGGCTCCAGTACAGCAGAGACTTTGGGAAACTGCTCTTGAGCATCAATGTGACTAATATCCGGAGCAGGCAGCGGGCTGGAGAAGATGCCCACGAGGCGCAGCTCACCCTGGCGGTACCTCCCGCCCTGCTACCGTCCTCAGTGCGCCCTTTTGGGGCCTGCCAGGGCAACGAGACTATCCTTTGCCACCTGGGGAACCCCTTCAAACGGAACCAGCGGGTGAGCACTGTTCACCCTCTCCCAGACTATACTCCTCCAGTGAATTTCTTACCTTTCTTGCTTCTGCCTGCCTGCTTCCAGGGCTTCCTTGAAGCAAAGAGAGTAAGGAAGGAGATAAGTAAGCAGGGGTGGGGTGGGATCCAGAGATTGAGAGAAATGGGGCCAGTAGAGAGCTATGCACAAAGCTAGAGCAGGTGGAGGTAAGGAAACCAATTTTGCTGATCACCAGGCCCCAAGCCTAACACTTTGCTTCTTTTATATGATATAGTTCTCACAACCTTCTGAGGTGGTAGATGCTGTTTTACAGAAAGGAAACACAGACTTAGAAAGTTTCAGTAACTTGCCTAAGGTCATATAGCTCAAAAGTAGCAGAAATGTCATTGAAAAATAAGGAGGAAAGGGAAGCAAAGATGAGGCTAGGACATTGAAAGAGTGGAGATGGGTGGGGAGGTAGAGACCCCTCACTCAGAATGGGGAAAGAGGAGGACAGAGAACCAACTCCCAAGCATCATATTCAGCTTTCTCCCAACCATGGCATCACCCCTGCTTGGCCCCAAACGCCCCTCTCTGCCTCCCTGGCCCTCATGGCAGATGGAGCTACTCATCGTCTTTGAGGTCATCGGGGTGACCCTGCACACAAGGGAGCTCCAGGTGCAGCTGCAGCTGTCCACGTCAAGTCACCAGGACAATCTGCAGCCCATGACCCTGACTCTACTGGTGGATTACATGCTCCAGGCCTCACTCAGCATGGTGAGTCACCGGCTACAAAGCTACTTTGGGGGAACAGTGATGGGTGAGTCTGGCATGAAAACTGTGGAGGATGTGGGGAGCCCTCTCAAGTATGAGTTCCAGGTGAGCCCAATGGGGGAAGGGCTGGCAGCCCTGGGCACCCTGGTCCTAGGACTGGAGTGGCCCTACGAAGTCATCAATGGCAAGTGGCTGCTGTACCCTACAGAGATCACCATCCGCGGCAATGGGTCCTGGCCCTGCCAGCCACCCGGAGACCTTGTCAACCCTCTCAACCTCACTCTCTCTGTCCCTGGGGATAGGCTGCCAACTTCACAGCGTAGGCGAAGACAGCTTGACCCAGGGGGAGGCCAGGGCCCCCCACCTGCTACTCTGGCTGCTGCCAAAAAAGCCAAGTCTGAGACCCTGCTGAGCTGTGGCAGTGACCACACCCGCTGCGTGTGGCTGGAGTGCCCTATTCCTGATGCCCCTGTCATCACCAATGTGACTGTGCAGGCTCGAGTGTGGAACAGCACCTTTATTGAGGATTACAGGGACTTTGACCGAGTCAGGGTAACCAGCTGGGCTACCCTGTTCCTCCGAACCAGCATCCCCACCATTAACATGGAGAACAAGACCGTGCCGTTCTCTGTGGACATTGACTCTGAGCTGGTGGAGGAGCTTCCAGCTGAGATCGAGCTGTGGTTGGTGCTCGTGGCTGTAGGTGCCGGGCTGCTGCTGCTGGGGCTCATCATCCTCCTGCTATGGAAGTGCGGCTTCTTCAAGCGAGCCCGCACTCGCGCCCTGTATGAAGCCAAGAGACAGAAGGCGGAGATGAAGAGCCAGCCGTCAGAAACAGAGAGGCTGACCGAAGACTACTGAAGGGGGCGGCCCCTGCCCCCAACCCACCCGGTGTGACTTCTTTAAACGGACCCACTATTACCAGATCATGCCTAAGTACCACGCGGTGCGGATCCGGGAGGAGGAGCGCTACCCACCTCCAGGGGAGACCCTGCCCACGAAGAAGCACTGGGTGACCAGCTGGCACACTCGGGACCGATACTACTGACATCCTCCCTGATCCCACCCCCGTGCCCCCAGTGTCCCCTTCTATTTATCATAAGTTATGCCCTGACAGTCCACAGGGGCCACTGCCTTTGGCTGGCGCCAGCAGGCTCAGGCACACACACCTCTTCGAGCGCATACATGTGTCGTCTGGCCACAGACTTCTCCGCGCAGGAGTGCTGGGACCGTGGACCTTGCTCTGCCAAGCACACCACAGA