Transcript asmbl_76396

Sequence
Transcript Sequence for observation asmbl_76396 of TGE0007383:
CGGAGAGAAGCCCTCAGAGGCCAGGACAAAAGCCGGATCCCGGGCGGTGGCGGGAGGGTGGCGCGCTCCGGGTAGTGGCCTGTGATTCAAGGCCTGTGGAGGGAGCGCCGCGCACAGACTTTCGCAGAGAGGTAGAGCAGGTCCCTCTGCAGCCATGTCGGCCAAGGCGATTTCAGAGCAGACTGGCAAAGAACTTCTTTACAAGTACATCTGCACCAGCTCGGCCATCCAGAACCGGTTCAAGTATGCCAGGGTCACCCCTGACACAGACTGGGCCCATCTGCTGCAGGACCACCCCTGGTTGCTCAGCCAAAGATTGGTGGTCAAGCCAGACCAACTGATCAAACGACGTGGAAAGCTGGGCCTAGTTGGGGTCAACCTCACTCTGGATGGTGTCAAGTCCTGGCTGAAGCCACGGCTGGGACAGGAAGCTCTGGTAGGCAAGGCCAGAGGCTTACTCAAGAACTTTCTGATCGAACCCTTCGTCCCACACAGTCAGGCAGAAGAGTTCTACGTCTGCATCTATGCTACCCGAGAAGGTGACTACGTCCTGTTCCACCACGAGGGAGGGGTGGACGTAGGCGACGTGGATGCCAAAGCCCAGAAACTGCTCGTTGGTGTGGATGAGAAGCTGAATCCTGAGGACATCAAGAAACACCTATTGGTCCATGCCCCTAAAGACAAGAAAGAAATTCTGGCCAGTTTTATCTCCGGCCTCTTCAATTTATATGAAGATCTGTACTTCACCTACCTCGAGATCAACCCCCTTGTTGTGACCAAAGATGGCGTCTACATTCTTGACTTGGCGGCTAAGGTAGATGCCACTGCCGATTACATCTGCAAAGTGAAGTGGGGCGATATAGAGTTCCCTCCCCCCTTTGGGCGTGAGGCTTATCCAGAGGAAGCCTACATTGCAGACCTGGATGCCAAAAGTGGAGCAAGCCTGAAGCTGACCTTGCTGAACCCCAAGGGGAGGATCTGGACCATGGTGGCTGGGGGTGGTGCCTCAGTCGTGTACAGTGATACCATCTGTGACCTAGGGGGTGTCAATGAGCTGGCGAACTATGGGGAGTACTCGGGTGCCCCCAGCGAGCAGCAGACCTATGACTATGCCAAGACGATCCTCTCCCTCATGACCCGCGAGAAGCACCCAGATGGCAAGATCCTCATCATTGGAGGCAGCATTGCGAACTTTACCAACGTGGCTGCCACGTTCAAGGGTATTGTGAGAGCGATTCGAGATTTCCAGGGCCCCCTAAAGGAGCACGAGGTCACTATCTTTGTCCGAAGAGGTGGTCCCAACTATCAAGAGGGCTTACGGGTGATGGGAGAAGTTGGGAAGACCACTGGAATCCCCATCCATGTGTTTGGCACAGAGACTCATATGACGGCCATTGTGGGCATGGCCCTGGGCCACCGGCCCATCCCCAATCAGCCACCTACAGCCGCCCATACTGCAAACTTCCTCCTCAACGCCAGTGGGAGCACATCGACTCCAGCCCCCAGCAGGACTGCGTCTTTTTCTGAGTCCAAGGCTGATGAAGTGGCACCTGCAAAGAAGGCCAAGCCTGCTATACCACAGGATTCAGTCCCAAGTCCAAGATCCCTGCAAGGGAGGAGTGCCACCCTCTTCAGCCACCACACCAAGGCCATCGTGTGGGGCATGCAGACGCGGGCCGTGCAAGGCATGCTGGACTTTGACTACGTCTGCTCCAGAGACGAGCCCTCAGTGGCTGCCATGGTCTACCCTTTCACTGGGGACCACAAGCAGAAGTTTTATTGGGGTCACAAAGAGATCCTGATCCCTGTCTTCAAGAACATGGCTGATGCCATGAAGAAACACCCTGAGGTAGATGTGCTGATCAACTTCGCCTCTCTCCGCTCCGCCTATGACAGTACCGTTGAGACCATGAGTTATGCACAGATCCGGACCATTGCCATCATAGCTGAAGGTATCCCTGAGGCCCTCACGAGGAAGCTGATCAAGAAGGCAGAGCAGAAGGGTGTGACCATCATTGGACCTGCCACTGTTGGAGGCATCAAGCCTGGGTGCTTTAAAATCGGGAATACAGGTGGGATGCTGGACAACATCCTGGCTTCCAAACTGTACCGCCCTGGCAGCGTGGCCTACATCTCGCGTTCTGGGGGCATGTCCAACGAGCTCAACAATATCATCTCTCGAACCACGGATGGTGTCTATGAGGGCGTGGCCATTGGTGGGGACAGGTACCCTGGTTCAACATTTATGGATCACGTGTTACGTTACCAGGACACTCCAGGAGTCAAAATGATTGTGGTTCTTGGAGAGATAGGGGGCACTGAGGAGTATAAGATCTGCCGGGGCATCAAGGAGGGCCGCCTCACCAAGCCTGTGGTCTGCTGGTGCATCGGGACCTGTGCTACCATGTTCTCTTCTGAGGTACAATTTGGCCATGCCGGAGCTTGTGCCAACCAGGCTTCTGAAACTGCAGTAGCCAAGAACCAGGCTTTGAAAGAGGCAGGAGTCTTTGTGCCCCGGAGCTTCGATGAACTTGGAGAAATCATCCAGTCTGTGTACGAGGATCTTGTGGCCAAAGGGGCCATTGTACCTGCTCAGGAGGTACCGCCCCCGACGGTGCCGATGGACTACTCCTGGGCCAGGGAGCTGGGCTTGATCCGCAAACCTGCCTCATTCATGACCAGCATCTGCGACGAGCGAGGACAGGAGCTCATCTACGCGGGTATGCCCATCACTGAGGTCTTCAAGGAAGAGATGGGCATTGGCGGGGTCCTCGGTCTCCTCTGGTTCCAGAGAAGGTTGCCCAAGTACTCCTGCCAGTTCCTTGAGATGTGCCTGATGGTGACAGCCGATCATGGGCCAGCCGTGTCTGGCGCTCACAATACCATCATCTGTGCTCGGGCTGGGAAGGACCTGGTTTCCAGCCTCACCTCGGGGCTGCTCACTATTGGGGACCGGTTTGGGGGCGCCCTGGATGCAGCAGCCAAGATGTTCAGCAAAGCCTTCGACAGTGGCATTATTCCCATGGAGTTTGTAAACAAGATGAAGAAGGAAGGAAAACTGATCATGGGCATCGGTCACCGAGTGAAGTCGATAAATAACCCAGACATGCGAGTGCAGATCCTCAAAGATTACGTCAAACAGCACTTCCCTGCCACCCCCCTGCTCGACTATGCGCTGGAAGTGGAGAAGATTACCACCTCAAAGAAACCGAATCTTATCCTGAATGTAGATGGCTTCATCGGAGCTGCATTTGTAGACATGCTTAGAAACTGTGGGTCCTTTACTCGGGAAGAAGCTGATGAATATATTGACATTGGAGCCCTCAATGGCATCTTTGTGCTGGGAAGGAGTATGGGCTTCATTGGACACTATCTTGATCAGAAGAGACTGAAGCAGGGGCTGTATCGTCACCCATGGGATGATATTTCATATGTTCTTCCGGAACACATGAGCATGTAACTGAGCCAGGAACTGTGTTGCAGTAAAGTGAAGACAAGATCTCCTCCCCCCAGAAATAGTGTGCAGACAGCTGGCACTGGAGCTTGCTATAGGATGGGCCTGGAATATAAACAGCCGTTGGTATACAGGCACCGAAGACCAATACTCACAGGCTAACACTGTTTAGTCCACACAATGAAGCTTAATATTTTTTTTATAAGCATAGAAATAAAAACCAAGCCAATATTTGTGACATCTGCTCTGCCACCTGCTGTGTTTATTATATAAAAGCATCTAAGCACTGTCAGGATGGCATTTTTCCTTATTATAGGGCGTTATAATGTTGCTTTCTTTTTTCCGTTAGTTAAAAATTTTCCCTTGGAGGAAGGGAATGAAACTTTTAAGACTTCAAGATATTATACATTTAAAGCATCCCTAATGTCTTGTTTTCCTGCTTATATAACCTGAAGAGCATTGTATTAATCTGATTTTTTTTTATGATCTTTTTGTATGTTATGCGTGAAGGATTTGTTCGGTATCTCACTGAAACATTTCATGTTGTAGACTAAAGTCTGCTTCTGTCAGGGGGATTGGACCATTGCATCCTTAGCCACTATCACAAAATATGTGGAATAGTGATTTAAAATGTAAAGTTGCAACATACATGTTTAAAATGGAAACACAAAGAAAAAGCTGTGAAATGTCTTGTGTCTTATGTTCTCTGTATTTATGCAACTGATCTGTCTTACTGAAGTCTGGGTCCAAGGACTCATCTCCAACCAGTTTGCATCTGTAATCCACAAAGATTCTGGGCAGCTCCCACCTCAGTCTCTTCTCTGTATTATCATAATTTGGTTTAAATAAACTATATAGTAACAATGAA