Transcript asmbl_13149

Sequence
Transcript Sequence for observation asmbl_13149 of TGE0003680:
CGTGGCCCAAGCCATGCCCACCAGCGGTTCCTTATTTGTCACTTGGTGACTGGTGTGTGCGGGGTCTGGTAGCCGCACTCTAGAAGGTTATTGCTCGCTGGCCCTCAGGTGTCCCGCTGATATCCCGGAAAATGACGGCTTCTTACGGCACGCGAACGACACCTCCCCGCTGCCACAAGAACCTTTTTCATTCTTGCCGCTTCGTTGGGATCTTTTTGATGACTCTAGTTATCCTGTTACCGACATCCTCCGATGCTTGTGATGATCCACCGAGATACGAATCTATGATGCTCAAGGATGTTTCTAAAGACTTGTATCTTCCTGGGGACCAAATAGAATTTAAGTGTCGCCTAGGATTCAAGCCTATTATACCTCTTCTTCCCACCACTGCTATTTGTCAGTCTGATAACACATGGACACCTCTCCAGGAGGCTTGTACAAGAAAATCATGTCCACAACTAGCAGACCCTTCAAATGGTCAAGTAAATGGAACTTTTCTGTTTGGTTCAGAGGTTCACTTTGTTTGTAATGAGGGTTATGAATTAGTTGGAACAAAAATTCTATATTGTGAAATTTCTGAAAATAATGTGGCTTGGAGTGGTGATCCCCCACAGTGTGAAAAGATTATGTGTCAACCACCTGGAGACATACCAAATGGAAAACATACCAGTAGCCACAAGGATGTATTTGAATATAATGAAGTAGTAATTTACAGCTGCAATCCTTCAGGAGGACCAGACGAATATTCACTTGTTGGAGAGAGCAGACTAGTTTGTTCTGGGAGAGACACATGGAGTAGTGCCCTTCCTGAGTGTAAAGTGGTCAAATGTCAATTTCCAGTAGTCAAAAATGGAAGACTGATAGCAGGATTTGCAAGAAAATTTTACTACAACGCGCAGGTTGTATTTGAATGCGTCCAGGGTTTTCACCTTAAAGGCAACAGCACAATTGTCTGTGGCGCTAACAATGAATGGCAGCCTAAGATGCCAGAATGTATTGAAGGTCTCAAGCCTACTAGTCCAGCCACATCTCCAGTTCCAAGACCCACAGATTCAGAACATGCCACTCCCGGTGATGAACCACCTAAATATTTAGGTGGAGGAATCATTGCTTTGATTGTTATTGTTACAGTTGTTGGCATTGCACTAATTTGCTGCATCGTGTGGATAGTTTTGCACAAAAAGAAGAAAAGGTTGCAGGAAAACCGTTGGGGTTAAAATTAAAGTTGCTGAGAGGGGGAANNNNNNNNNNTGCATACAGCTTACCATAATAAATCAAGCACTCCAGCAGAGCAGACAAACTAAACATTTTCCAAAAACGGGTGAAACACTTTATTTTTTGATTCTGTTAAAATGTCAAGATCTGCATTCAATTTGTATAGCTATTATTAAAACAGTATGGAGGCTCTTCAGATCATTAAAAACAGGACTATGTGGTTGACCAATTCCACTTCTGGGGATCTCTCCTAAGGAAACAAAATCACACTGTGAAAGAGATACCTGCACCTCCCTGTTCCTTGCAGAATTATTTACAGTAACTAAGACTTGGAAACAAGCTAGCTGCCATTAACAGATCATTGGATAAAGAAAATCAGGAATACATATACAGTGGAATACTACTCAGTCATAAAAACGGGAATCTTGATGACACGAATGGACCTTGAGGGCATTTTGCTATGTGAAATAAGTCATACACAGAGGCAAACACTGTGTGATCTATGTATAGAATCTAACTAACAAACTCAAAAAGAAAATCAGATTTGTGGGTGCCAGAGGGGGTGGGTTGGTATGGCGGGTTGAGGAAGTTGGGTGAAAGAGGTCAAAAGGTGCAAACTTCCAGTTATAAGCATGTATTGGGATGTAATGTATAATATAGTGACTTTAATTAGTAATACTATAGTGCATATTGGCAAGTTCCTAAGAGATCTTAACAATTCTGATCATTAGGAAGGAAAAAATTTTGTTAAATATGAGGTGATGGATGTTAACTAAATTTGTAATTATTTCATAATATACACATTACCAAATCATGCTGTAAACCTTAAACTTACAGAATGTTCTATATTAATTATATCTCAATAAAACTGGAAGGAAAATAGATCTACAAAGTTATTCTCTAGTCCTTTTCACTCTCATGAATCCAACTGTTAAGGCATAGGACTAACATTTATTATCGCTCGAAAGTAGTCACCATCCTTCGATGCTTCTTTGAAACGATATGAATTTGGTATGAACCTCGTGCCTGTTTCCCCCTAAATGACACTTGCATTTATAGGGCAAGTCAACACAGTATCCCTGGTAGTATTAAAGTGGAAAAGTGTTTTATAAAATCTCCAAATTTAGAGAAATATAGTTCAAAATGAAATTACATTTCATTTATAAAGAGTAACTTTGAAATCTTTTTTTTTTCAAAAGTTAATGCCAACTCTTAAGGTTCACTCTTTCAGCAACTCTTATGTGTACTATATATTGTTTAAAAAGTCTGTACAAATATGTATATATTACTTCAGCCTTTAAAAATTAAAAATAGAAAAATTTGGAATTTGAACGTTTGACTTTCTTAACTAAGTATATTATTGGAAAATACTTTTATAGTTAGTAGGGTAAAATTCTATTTAAAAAAATTAATGCATGGCATTTGTTCACCATTTTTAATAGCAATAACCAGAAATCAGTAATAATTTGGAATCATTTGCATACTTCTGTAAAAAGTTAGAGGGCTCTAACACCCACAACAAGAATGCCAGCTTGGTACAAAGTGAACACAGTGGCCTTGTCTTTTCAAGGAGAATTCCACTTTTTAAGACGTAGACTCCACTCTAAATTCTGGCGTAGGTGGTTTTCTCTCCCTCCTTGAAGAGATGTCTCACTTAAACAAGTCATCTAAATGCAGGCCGTTCTGCAGGGAGTAAACTCATCAGATAACCTCACGTTCTATCAGGATCTCGGTCTGTGTGTGTATCCCACCTCACCTGCTGAAAGGCAGGGTAGACCGTAAGCCATGTATTTCAGAAAAGAACGCTTAACTTTGTGTGCTGGTTGTTGGTGCTAGGAAGGGAAGAAAGAACCCCCAGGTCAGGCAGAGCTCTCCGCTCAGGTGGAATAGATGCCCCCTCTTCTGAGTCCTCACACCAGGCAGGGCACTTGCAAATGAGCCAGCTGGCAAAGAGGAGGAACCGCCCCTCTCATTCATCTTTACAAGTTTTGTTTCACACTTTTATATTTAGTACCACAAATTGGGCCAAGAAATGTTGCCTTGAGAAGGACGTGATTGGGGAATCAGAGTGGGCCAGGGCAAATACTGTTTTACTCTTATAAAGACATGTTTATAATGCACCACAAGTGTTCCTTCCCTTTGTCATCTCTGGTGCCAGACTTTAGGAAGATGAGTTTGAGCAGAAATAAACGTTTTCTGAATTAAATATAGAGAAGTTTACTACACCCATTTTCACATGCTTATTTTCAAGAATTGGCACTTGCTTAGAAGCAGAGATGGCTGTACTCTTACTTTTTTAACGTCTATTTGAGGTATTTTTCAACCAAAGCTTGTTATGCTTTACCAAAATAAAGTTTCTGCTTCAAATTTACCTTTTTTCAATTTAATATATATGAGTGATGTATGTGTAAATATTGTTTGTCAAATAATTTGTCAATTACTGAAGTATATGGGCAAACCAGTTTTCTGTAGAAAAGTTTAAATGACAGGGAAAGAAACATATTTGAACTAAAAGTGTCTTAAAACTGGAAGAATGTATTCAACAGTGAAATGGGAAGTCCTGTGTAAGAGAGGTCCTTATTGTTCATTTTTTGAAAATTCGATTCTCGAATCTGATAAAAATAAAATGGATTAAGAAGA