Transcript asmbl_76003

Sequence
Transcript Sequence for observation asmbl_76003 of TGE0000759:
AAAGGACCAGAGGGAATACGGGCGAAAGCAGAGCGAGGGTTGGCCTCTCCCCTTCACAAATAATGGGAGGAACCTGGCAAGAGGGAGTTCTTTCCTTTCGCCGCTGCGGTCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTTGCCTCCAGTGTTCTGCGCTGTGGCAAAAAGAAGGTCTGGTTGGACCCCAATGAGACCAATGAAATTGCCAATGCCAACTCTCGTCAGCAGATTCGGAAGCTGATCAAAGATGGGCTGATCATCCGGAAGCCTGTGACTGTCCATTCCCGAGCACGATGCCGGAAAAACACCTTGGCCCGCAGAAAGGGCAGGCATATGGGCATAGGTAAGCGAAAGGGTACTGCCAATGCTCGAATGCCTGAGAAGGTAACCTGGATGAGGAGGATGAGAATCCTTCGCCGACTGCTCAGAAGATACCGTGAATCTAAGAAGATTGACCGCCACATGTATCACAGCCTGTACCTGAAAGTGAAGGGTAATGTGTTCAAAAACAAGCGGATTCTCATGGAACATATCCACAAGCTGAAGGCAGACAAGGCTCGCAAGAAACTTTTGGCTGACCAAGCTGAGGCCCGTAGATCTAAGACCAAGGAAGCACGCAAGCGCCGTGAAGAGCGGCTCCAGGCCAAGAAGGAGGAGATCATCAAGACTCTGTCCAAGGAAGAAGAGACCAAGAAATAAAGCACCACCTCTCTTACCTGTACATAGTGGCCTTGGCAATTATATAGATCAATCCTTCAATAAAATAGCTTTCATCTGCCTACCTCTCTGTTCTTCCAAAGTTTCTGGCTGTTTGATGAGTCTTCACTATTTAGAGGGCCAGAACTGAGCACACCGAGTTCTGAGATGCAGACCCTCTCCAGAGTGCCAGTTTTCATTCTTTCCTTGGCTCCTGGCCTCTGATAAGGCTCATGACCCCTCTGTCCATGGAAGAGACGGTTTTTTTACCTTGTTTTAGTGGGATGTGGGGCTTACTTTGAAGGGAGGGAAGGAATGACTTCTACTCAACTTCCGAAGTGCTGTGCTTTAAACTGCCTTTTACAGTAGAGCGTGAGTGGCATTTCAGAAGTGGTCTCAGATGTTGGTTGGGAACCAATAGTTGTGACATCAGCTGTCATTGTTTTAAAAACAAAAAACAGAATGCTTACACTTTTCAACTGGGCACTGGGGTCCAAGGTTGAAATCTGCCCTAGAACTCAAGGACAGTGAGAGTTTCAACCACCTCCAGTCAAGCTAATGACACCTGGACTTCACTGACTGCTACCTATGCTTTCTCTAAACAACTTTATTGAAGCTGTCATTTTGAACATTCCAGTTTCTAAACCTTTA