Transcript asmbl_12604

Sequence
Transcript Sequence for observation asmbl_12604 of TGE0003675:
AGGTGCCATATTCAGGACAGAGCAATTCATTTCTATTCTGTTCTCCCCGTTGTACCCACAAGCAGGTGACAAGTTCGTCTTCGCTACTAGACGATAAAGACAGCATTCAAGGAAGTCGTAAGGCAGCACGACTCCCCATCTTCCCATAGTAAAGATGGAGGCGCCCTGCATGTAAACGACAGGTAAAACTACTTCCGCCTTTCTCCTGCGCCCTCGTCCAAGATGGCGGACGAGGCCACCCGGCGTGTCGTGTCTGAGATCCCGGTGCTGAAGACTAACGCCGGACCTCGAGATCGGGAGTTGTGGGTGCAGCGACTCAAGGAGGAATACCAGGCTCTTATCCGGTATGTGGAGAACAACAAGAATGCGGACAATGATTGGTTCCGACTGGAGTCCAACAAGGAAGGGACTCGGTGGTTTGGAAAATGCTGGTACATCCACGATCTCCTCAAATATGAGTTCGACATCGAGTTTGACATTCCTATCACATATCCTACTACTGCTCCAGAAATTGCAGTCCCTGAGCTGGATGGAAAAACAGCAAAGATGTACAGGGGTGGCAAAATATGTCTGACCGATCATTTTAAGCCTTTGTGGGCCAGGAACGTGCCCAAGTTTGGATTAGCTCATCTTATGGCTCTGGGGCTGGGTCCATGGCTGGCAGTGGAAATCCCCGATCTAATTCAGAAAGGCGTGATTCAGCATAAAGAGAAATGCAGCCAATGAAGGATCAAGCCGCTGAGGCTGAGACTTGGATAGGCTACGTTCCTGTTTTCCTGTGCATCCCTCTTCTTACTCATCCGACCGCTTCACTCACACCCCTTCGCCTACAGCGGTTACTAAGTAGCTGCAGCGGTACAGTTTCCAGCATTGCCGGGGTGAAAAAACAGTGTTGCTACTGAGTTTCTAAGTTAGGCTGTACAGGGAGGGGAGAGGCTGGGGCTTTGGAAAAACCGAAAGGTAATTTATACCCCTTCCCCAGGCGGAGCGGTGTGAGATCCTGGAAGGACAGGGGATGGTTGAAAGTGGGTACACAGTCTTTTTGGTTTCCGGAAATAACTCATCAATAAAAGCTGCTTCTTCTGGTG